Fancl (NM_001277273) Mouse Untagged Clone

CAT#: MC227325

Fancl (untagged) - Mouse Fanconi anemia, complementation group L (Fancl), transcript variant 2


  "NM_001277273" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Fancl"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fancl
Synonyms 2010322C19Rik; AW554273; B230118H11Rik; gcd; P; Phf; Phf9; Pog
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227325 representing NM_001277273
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAAGCAGAAGCAAGCCTGTTGCGCCATTTCCCGCTGCTACTTCCTCAGAACCGGGAGAAAACTG
TGTATGAGGGATTCATTTCGGCTCAGGGAAGTGACTTTCACCTCAGAATAGTGCTGCCTAAGGACCTGCA
GCTCAAGAAGGCAAGATTACTGTGTAGCCTGCAGCTGAAAAATATACTTAATGAGTACCATCAAGTAGTC
CAACAGAGAATGAAGCACTCTCCTGATCTAATGAGTTTTATGATGGAATTGAAGATGATTTTGGAAGTTG
CTTTAAAGAATAAGCAAGAGTTGTGTGTACAACCACCTTCTTGCAGTTTCTGCAAAGACCTTCTTACTGA
GATAGGAGCCATTGGTTGGGATAAACTCGCATGTGTGGAGAGTTCCTTCAGCACCATCAAGTTAAAAGCA
GATGATGCTTCTGGTAGGAAGCACCTAATCACTGTCAAGTTGAAGGCAAAGTATCCTGTAGAGCCACCAG
ATTGTGTTGTGGACTTTCCTGTCCCATTTTCTGTTTCCTGGACACCACAGAGCTCCTTGGTAGATGTTTA
TAGTCAGTTCTTGGTGGCATTAGAGACGCTGAAGGTGTTCTGGGATGTTATGGATGAAATTGATGAGAAG
ACCTGGGTGCTGGAGCCAGAGAAACCTCCCCGGAGTGCAACAGCACGCAGGATTGCATTAGGAAAGAATG
TTTCCATAGCCATCGAGGTGGACCCCAGGCACCCTACCATGCTTCCTGAGTTTTGCTTTCTTGGAGCTGA
CCATGTGACAAAACCCCTGGGAATGAAGCTGAGTGGTAGCATTCATTTATGTCTGTTACAAAATTTGAAA
GATGTTTTAGAAATTGATTTCCCAGCTCGTAGTATCTTGGAAGAATCTGACTTTAGCATGGACTGTGGAA
TCTGTTATGCCCGTCACCTGAATGGTGCCATTCCTGATCAAGTGTGTAATAATCCCCAGTGTGGACAACC
TTTCCATGAAATATGTCTGTATGAGTGGCTGAGAGGGTTGAGCACCAGCAGACAGAGTTTTAACGTCTTC
TTTGGTGACTGTCCCTATTGTAGTAAGCCAATTACCTTGAAAATGTCTGGGAGAAAACCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277273
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277273.1, NP_001264202.1
RefSeq Size 1783 bp
RefSeq ORF 1113 bp
Locus ID 67030
UniProt ID Q9CR14
Cytogenetics 11 A3.3
Gene Summary This gene encodes the complementation group L subunit of the multimeric Fanconi anemia (FA) nuclear complex composed of proteins encoded by over ten Fanconi anemia complementation (FANC) group genes. The FA complex is necessary for protection against DNA damage. This gene product, an E3 ubiquitin ligase, catalyzes and is required for the monoubiquitination of the protein encoded by the Fanconi anemia, complementation group D2 gene, a critical step in the FA pathway (PMID: 12973351, 21229326). In mouse, mutations of this E3 ubiquitin ligase gene can lead to infertility in adult males and females, and a deletion of this gene can cause embryonic lethality in some genetic backgrounds. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site in the coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.