OriGene Logo

Kcnab2 (NM_001252656) Mouse Untagged Clone

Be the first to review this product
SKU
MC227304
Kcnab2 (untagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, beta member 2 (Kcnab2), transcript variant 1
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $503.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA397439S beta Catenin Antibody
25 ul
$300.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Kcnab2 or NM_001252656"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Kcnab2
Synonyms F5; I2rf5; Kcnb3; kv-beta-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227304 representing NM_001252656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTATCCGGAATCAACCACGGGGTCCCCAGCTCGACTCTCCCTGCGGCAGACAGGCTCCCCCGGGATGA
TCTACAGTACTCGTTATGGGAGTCCCAAAAGACAGCTCCAGTTTTACAGGAATCTGGGCAAATCTGGCCT
TCGGGTCTCCTGCCTGGGGCTTGGAACATGGGTGACCTTCGGGGGCCAGATCACGGATGAGATGGCAGAG
CACCTAATGACCTTGGCCTACGATAATGGCATCAACCTGTTCGATACGGCGGAGGTCTACGCTGCTGGAA
AAGCTGAAGTGGTATTAGGGAACATCATTAAGAAGAAGGGATGGAGACGGTCCAGCCTTGTCATCACCAC
CAAGATCTTCTGGGGTGGAAAAGCGGAGACTGAGAGAGGCCTTTCCAGGAAGCACATAATTGAAGGACTG
AAAGCGTCCCTGGAGCGGCTGCAGCTGGAGTACGTGGATGTGGTTTTTGCCAACCGCCCAGACCCCAACA
CGCCCATGGAAGAGACCGTGCGGGCCATGACCCATGTCATCAACCAGGGGATGGCCATGTACTGGGGCAC
ATCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCGGTGGCTCGGCAGTTCAACCTGATCCCGCCC
ATCTGCGAGCAAGCGGAATATCACATGTTCCAGAGGGAGAAGGTGGAGGTCCAGCTGCCAGAGCTGTTCC
ACAAGATAGGAGTAGGTGCCATGACCTGGTCCCCTCTGGCGTGCGGCATCGTCTCAGGGAAGTATGACAG
CGGGATCCCACCCTACTCCAGAGCCTCCCTGAAGGGCTACCAGTGGTTGAAGGACAAGATCCTGAGTGAG
GAGGGTCGCCGCCAGCAGGCCAAGCTGAAGGAACTGCAGGCCATTGCCGAACGCCTGGGCTGCACCCTAC
CCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGTGTCAGCTCCGTGCTTCTGGGTGCTTCCAATGC
AGAACAACTTATGGAGAACATTGGAGCAATACAGGTCCTTCCAAAATTGTCGTCTTCCATCGTCCACGAG
ATCGACAGCATTCTGGGCAATAAACCCTACAGCAAAAAGGACTATAGATCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001252656
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001252656.1, NP_001239585.1
RefSeq Size 3633 bp
RefSeq ORF 1104 bp
Locus ID 16498
UniProt ID P62482
Cytogenetics 4 83.08 cM
Summary Cytoplasmic potassium channel subunit that modulates the characteristics of the channel-forming alpha-subunits (PubMed:8576199). Contributes to the regulation of nerve signaling, and prevents neuronal hyperexcitability (PubMed:11825900, PubMed:21209188). Promotes expression of the pore-forming alpha subunits at the cell membrane, and thereby increases channel activity (By similarity). Promotes potassium channel closure via a mechanism that does not involve physical obstruction of the channel pore (PubMed:8576199). Modulates the functional properties of KCNA4 (By similarity). Modulates the functional properties of KCNA5 (PubMed:8576199). Enhances KCNB2 channel activity (PubMed:8824288). Modulates the functional properties of KCNA5 (PubMed:8576199). Binds NADPH and has NADPH-dependent aldoketoreductase activity (By similarity). Has broad substrate specificity and can catalyze the reduction of methylglyoxal, 9,10-phenanthrenequinone, prostaglandin J2, 4-nitrobenzaldehyde, 4-nitroacetophenone and 4-oxo-trans-2-nonenal (in vitro) (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes isoform 1. Variants 1, 2 and 5 encode the same isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001252656" in other vectors (1)
SKU Description Size Price
MR229515 Kcnab2 (myc-DDK-tagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, beta member 2 (Kcnab2), transcript variant 1 10 ug
$289.00 $457.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.