Gapdh (NM_001289726) Mouse Untagged Clone

CAT#: MC227265

Gapdh (untagged) - Mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh), transcript variant 1


  "NM_001289726" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Gapdh Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gapdh"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gapdh
Synonyms Ga; Gapd
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227265 representing NM_001289726
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCCCTTACCCCGGGGTCCCAGCTTAGGTTCATCAGGTAAACTCAGGAGAGTGTTTCCTCGTCCCG
TAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCAT
TTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCTTCATTGACCTCAACTACATGGTCTACATG
TTCCAGTATGACTCCACTCACGGCAAATTCAACGGCACAGTCAAGGCCGAGAATGGGAAGCTTGTCATCA
ACGGGAAGCCCATCACCATCTTCCAGGAGCGAGACCCCACTAACATCAAATGGGGTGAGGCCGGTGCTGA
GTATGTCGTGGAGTCTACTGGTGTCTTCACCACCATGGAGAAGGCCGGGGCCCACTTGAAGGGTGGAGCC
AAAAGGGTCATCATCTCCGCCCCTTCTGCCGATGCCCCCATGTTTGTGATGGGTGTGAACCACGAGAAAT
ATGACAACTCACTCAAGATTGTCAGCAATGCATCCTGCACCACCAACTGCTTAGCCCCCCTGGCCAAGGT
CATCCATGACAACTTTGGCATTGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAG
ACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCTGCCCAGAACATCATCCCTGCAT
CCACTGGTGCTGCCAAGGCTGTGGGCAAGGTCATCCCAGAGCTGAACGGGAAGCTCACTGGCATGGCCTT
CCGTGTTCCTACCCCCAATGTGTCCGTCGTGGATCTGACGTGCCGCCTGGAGAAACCTGCCAAGTATGAT
GACATCAAGAAGGTGGTGAAGCAGGCATCTGAGGGCCCACTGAAGGGCATCTTGGGCTACACTGAGGACC
AGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCT
CAATGACAACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATACGGCTACAGCAACAGGGTGGTGGAC
CTCATGGCCTACATGGCCTCCAAGGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289726
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289726.1, NP_001276655.1
RefSeq Size 1296 bp
RefSeq ORF 1080 bp
Locus ID 14433
UniProt ID P16858
Cytogenetics 6 59.32 cM
Gene Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein was originally identified as a key glycolytic enzyme that converts D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Subsequent studies have assigned a variety of additional functions to the protein including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Alternative splicing results in multiple transcript variants. Many pseudogenes similar to this locus are found throughout the mouse genome. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.