Rnf146 (NM_001284279) Mouse Untagged Clone

CAT#: MC227264

Rnf146 (untagged) - Mouse ring finger protein 146 (Rnf146), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rnf146
• Synonyms: 2610509H23Rik; Iduna
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227264 representing NM_001284279
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGATGGCCGGCTGTGGTGAAATTGATCACTCAATAAATATGCTTCCTACAAATAAGAAGGCAAATG
  AGTCCTGTTCCAATACTGCACCTTCTCTGACAGTTCCTGAATGTGCCATTTGTCTACAAACATGTGTTCA
  CCCTGTCAGTCTGCCCTGTAAGCATGTTTTCTGTTATCTGTGTGTAAAGGGTGCTTCATGGCTTGGGAAG
  CGATGTGCTCTTTGTCGACAAGAGATTCCTGAGGATTTTCTTGACAAGCCAACCTTGTTGTCACCAGAAG
  AACTTAAGGCTGCAAGCAGAGGAAATGGTGAATATGCGTGGTATTATGAAGGAAGGAATGGGTGGTGGCA
  GTATGATGAGCGCACTAGTCGGGAGCTAGAAGATGCTTTTTCCAAAGGTAAAAAGAACACGGAAATGTTA
  ATTGCTGGATTTCTGTATGTTGCTGATCTTGAAAACATGGTTCAATATAGGAGAAATGAACATGGACGTC
  GCAGGAAGATTAAGCGAGATATAATAGATATACCAAAGAAGGGAGTAGCTGGACTTAGGCTGGACTGTGA
  CACCAATACTGTAAATCTAGCAAGAGAGAGTTCTGCTGATGGTGCGGACAGTGGATCAGCACAGACTGGA
  GCTTCTGTTCAGCTTGCAGTGCCATCTTCTACAAGGCCCCTGACATCAGTTGATGGTCAGTTAACCAGCC
  CTGTAACACCATCCCCTGATGCAGGCATTTCTTTGGAAGACTCTTTTGCTCATTTACAACTCAGTGGAGA
  CAGCATAGCTGAACGGAGTCACAGAGGTGAAGGAGAAGAAGATCATGAATCGCCATCTTCTGGCAGAGTA
  CCAGATACCTCCGTTGAAGAAACAGAATCAGATGCCAGTAGTGATAGTGAGGATGCCCCTGTGGTAGTTG
  CACAGCACTCTTTGACCCAACAGAGACCTTTGGTTCCAAATGGAAACCAGACAGTAGCCGACCAGTCAGA
  CCGATCAGGAACTGACCGATCAGTTGCAGGGGGTGGGACCATGAGTGTCAATGTCAGATCCAGAAGGCCT
  GATGGGCAGTGCACAGTGACAGAGGTTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284279
• Insert Size: 1080 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001284279.1, NP_001271208.1
• RefSeq Size: 3932 bp
• RefSeq ORF: 1080 bp
• Locus ID: 68031
• UniProt ID: Q9CZW6
• Cytogenetics: 10 A4
• Gene Summary: E3 ubiquitin-protein ligase that specifically binds poly-ADP-ribosylated (PARsylated) proteins and mediates their ubiquitination and subsequent degradation. May regulate many important biological processes, such as cell survival and DNA damage response. Acts as an activator of the Wnt signaling pathway by mediating the ubiquitination of PARsylated AXIN1 and AXIN2, 2 key components of the beta-catenin destruction complex. Acts in cooperation with tankyrase proteins (TNKS and TNKS2), which mediate PARsylation of target proteins AXIN1, AXIN2, BLZF1, CASC3, TNKS and TNKS2. Recognizes and binds tankyrase-dependent PARsylated proteins via its WWE domain and mediates their ubiquitination (By similarity). May regulate TNKS and TNKS2 subcellular location, preventing aggregation at a centrosomal location. Neuroprotective protein. Protects the brain against N-methyl-D-aspartate (NMDA) receptor-mediated glutamate excitotoxicity and ischemia, by interfering with PAR-induced cell death, called parthanatos. Prevents nuclear translocation of AIFM1 in a PAR-binding dependent manner. Does not affect PARP1 activation (By similarity). Protects against cell death induced by DNA damaging agents, such as N-methyl-N-nitro-N-nitrosoguanidine (MNNG) and rescues cells from G1 arrest. Promotes cell survival after gamma-irradiation. Facilitates DNA repair. Neuroprotective protein. Protects the brain against N-methyl-D-aspartate (NMDA) receptor-mediated glutamate excitotoxicity and ischemia, by interfering with PAR-induced cell death, called parthanatos. Prevents nuclear translocation of AIFM1 in a PAR-binding dependent manner. Does not affect PARP1 activation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) has an alternate 5' UTR exon, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.