Tbpl2 (NM_001289689) Mouse Untagged Clone

CAT#: MC227207

Tbpl2 (untagged) - Mouse TATA box binding protein like 2 (Tbpl2), transcript variant 2

USD 340.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tbpl2 (NM_001289689) Mouse Untagged Clone
Symbol Tbpl2
Synonyms Gm348; Trf3
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC227207 representing NM_001289689
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGGGCTCTCTCATCATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGG
ATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATC
TAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTG
GATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGG
CAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGA
GCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAAC
CAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGA
ACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTG
TAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACCCAAAGAGGTTTGCTGCA
GTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAG
GAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAAGTATGCTCGTGTGGTGCAGAAGCTCGGGTT
CCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGG
CTGGAGATTTTGGCACTAACCCATCGGCAGTTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTT
ATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAA
AGAGCGTTCTGAGATCTATGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001289689
ORF Size 1050 bp
Insert Size 1050
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289689.1, NP_001276618
RefSeq Size 1731
RefSeq ORF 1050
Locus ID 227606
Cytogenetics 2|2 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.