Pbx1 (NM_001291508) Mouse Untagged Clone

SKU
MC227191
Pbx1 (untagged) - Mouse pre B cell leukemia homeobox 1 (Pbx1), transcript variant c
  $503.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pbx1
Synonyms 2310056B04Rik; D230003C07Rik; Pbx; Pbx-; Pbx-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227191 representing NM_001291508
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAGCAGCCGAGGCTGATGCATTCCCACGCTGGGGTCGGGATGGCCGGACACCCCGGCCTGTCCC
AGCACTTGCAGGATGGGGCCGGAGGGACCGAGGGGGAGGGCGGGAGGAAGCAGGACATCGGGGACATTTT
ACAGCAAATTATGACCATCACAGACCAGAGTTTGGATGAAGCGCAGGCCAGAAAACATGCTTTAAACTGC
CACAGAATGAAGCCTGCCTTGTTTAATGTGTTGTGTGAAATCAAAGAAAAAACAGTTTTGAGTATTCGGG
GAGCCCAAGAAGAGGAGCCCACAGACCCCCAGCTCATGCGACTGGACAACATGCTGCTAGCAGAAGGGGT
GGCGGGGCCTGAGAAGGGCGGAGGCTCGGCAGCGGCGGCGGCGGCAGCGGCAGCTTCTGGGGGTGCAGGT
TCAGACAACTCAGTGGAGCATTCCGACTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCACACAG
AGCTGGAGAAGTATGAGCAGGCATGCAATGAATTCACCACCCACGTGATGAACCTCCTTCGAGAGCAAAG
CCGGACCAGGCCCATCTCTCCGAAGGAGATCGAGCGGATGGTGAGCATCATCCACCGCAAGTTCAGCTCC
ATCCAGATGCAGCTGAAACAGAGCACGTGCGAGGCCGTCATGATCCTGCGCTCCCGGTTCCTGGATGCGA
GGCGGAAGAGACGGAATTTCAACAAGCAAGCCACAGAAATTCTGAATGAATATTTCTATTCCCATCTCAG
CAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGCGGCATCACAGTCTCCCAGGTA
TCAAACTGGTTTGGAAATAAGCGAATCCGGTACAAGAAGAACATAGGTAAATTTCAAGAGGAAGCCAATA
TTTATGCTGCCAAAACGGCTGTCACAGCCACCAATGTGTCAGCCCATGGAAGCCAAGCTAACTCGCCCTC
TACTCCCAACTCAGCGGGTGGATACCCTTCGCCATGTTATCAGCCAGACAGGAGGATACAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001291508
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001291508.1, NP_001278437.1
RefSeq Size 7050 bp
RefSeq ORF 1044 bp
Locus ID 18514
UniProt ID P41778
Cytogenetics 1 75.95 cM
Summary This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. provided by RefSeq, Apr 2014
Transcript Variant: This variant (c) lacks an alternate exon in the 3' coding region resulting in a frameshift compared to variant a. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. Variants b and c encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001291508" in other vectors (1)
SKU Description Size Price
MR229402 Pbx1 (myc-DDK-tagged) - Mouse pre B cell leukemia homeobox 1 (Pbx1), transcript variant c 10 ug
$289.00 $457.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.