Fut2 (NM_001271993) Mouse Untagged Clone

CAT#: MC227190

Fut2 (untagged) - Mouse fucosyltransferase 2 (Fut2), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fut2
• Synonyms: MFUT-II
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227190 representing NM_001271993
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGAGTGCCCAGGTACCTTTCTCCTTTCCTCTGGCCCACTTCCTCATCTTTGTCTTTGTGACTTCCA
  CCATCATCCACCTCCAGCAACGAATAGTGAAGCTCCAAACCCTGTCAGAGAAGGAATTACAGGCGGTTCA
  AATGTCCTCACCAAACGCGGCAAGAACAGACATGCAGCAGAGTGCCAAGCTGCAGGGCATATTCACGATC
  AATTCCATCGGCCGCCTGGGGAACCAGATGGGCGAATATGCTACATTGTTTGCACTGGCCAGGATGAACG
  GTCGGCTTGCCTTCATCCCTGAATCCATGCACAACGCTCTAGCGCCCATCTTCAGGATCAGTCTCCCGGT
  GTTACACAGCGACACAGCCAGAAGGATCCCGTGGCAGAATTACCACCTCAACGACTGGATGGAGGAGCGT
  TACCGCCACATCCCGGGGCAGTATGTGCGTTTCACGGGATACCCGTGCTCCTGGACCTTCTACCACCACC
  TGCGCCCAGAGATCCTGAAGGAGTTCACCCTGCACGACCATGTGCGTGAGGAGGCCCAGGCTTTCCTGCG
  TGGCCTGCGGGTGAATGGGAGCCAGCCGAGTACCTTTGTGGGTGTCCATGTGCGCCGAGGGGACTATGTG
  CATGTCATGCCCAAGGTGTGGAAGGGCGTGGTGGCTGACCGGGGTTACCTAGAAAAGGCCCTGGACAGGT
  TCCGGGCACGCTATTCATCTCCAGTCTTCGTGGTTACAAGCAACGGTATGGCCTGGTGCCGGGAGAACAT
  CAACACCTCCCTAGGAGACGTGGTGTTTGCGGGCAATGGTATTGAGGGCTCACCAGCCAAGGACTTCGCG
  CTCCTCACCCAGTGCAACCACACCATCATGACCATTGGAACCTTTGGGATTTGGGCTGCCTACCTGGCAG
  GTGGTGATACCATCTACCTAGCCAACTACACCCTTCCGGATTCTCCGTTCCTCAAAATCTTTAAGCCAGC
  AGCAGCCTTCCTCCCCGAGTGGATGGGCATCCCCGCAGACCTGTCCCCACTCCTTAAGCACTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271993
• Insert Size: 1044 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271993.1, NP_001258922.1
• RefSeq Size: 3073 bp
• RefSeq ORF: 1044 bp
• Locus ID: 14344
• UniProt ID: Q9JL27
• Cytogenetics: 7 29.41 cM
• Gene Summary: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.