Fut2 (NM_001271993) Mouse Untagged Clone

SKU
MC227190
Fut2 (untagged) - Mouse fucosyltransferase 2 (Fut2), transcript variant 1
  $503.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fut2
Synonyms MFUT-II
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC227190 representing NM_001271993
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGAGTGCCCAGGTACCTTTCTCCTTTCCTCTGGCCCACTTCCTCATCTTTGTCTTTGTGACTTCCA
CCATCATCCACCTCCAGCAACGAATAGTGAAGCTCCAAACCCTGTCAGAGAAGGAATTACAGGCGGTTCA
AATGTCCTCACCAAACGCGGCAAGAACAGACATGCAGCAGAGTGCCAAGCTGCAGGGCATATTCACGATC
AATTCCATCGGCCGCCTGGGGAACCAGATGGGCGAATATGCTACATTGTTTGCACTGGCCAGGATGAACG
GTCGGCTTGCCTTCATCCCTGAATCCATGCACAACGCTCTAGCGCCCATCTTCAGGATCAGTCTCCCGGT
GTTACACAGCGACACAGCCAGAAGGATCCCGTGGCAGAATTACCACCTCAACGACTGGATGGAGGAGCGT
TACCGCCACATCCCGGGGCAGTATGTGCGTTTCACGGGATACCCGTGCTCCTGGACCTTCTACCACCACC
TGCGCCCAGAGATCCTGAAGGAGTTCACCCTGCACGACCATGTGCGTGAGGAGGCCCAGGCTTTCCTGCG
TGGCCTGCGGGTGAATGGGAGCCAGCCGAGTACCTTTGTGGGTGTCCATGTGCGCCGAGGGGACTATGTG
CATGTCATGCCCAAGGTGTGGAAGGGCGTGGTGGCTGACCGGGGTTACCTAGAAAAGGCCCTGGACAGGT
TCCGGGCACGCTATTCATCTCCAGTCTTCGTGGTTACAAGCAACGGTATGGCCTGGTGCCGGGAGAACAT
CAACACCTCCCTAGGAGACGTGGTGTTTGCGGGCAATGGTATTGAGGGCTCACCAGCCAAGGACTTCGCG
CTCCTCACCCAGTGCAACCACACCATCATGACCATTGGAACCTTTGGGATTTGGGCTGCCTACCTGGCAG
GTGGTGATACCATCTACCTAGCCAACTACACCCTTCCGGATTCTCCGTTCCTCAAAATCTTTAAGCCAGC
AGCAGCCTTCCTCCCCGAGTGGATGGGCATCCCCGCAGACCTGTCCCCACTCCTTAAGCACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001271993
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001271993.1, NP_001258922.1
RefSeq Size 3073 bp
RefSeq ORF 1044 bp
Locus ID 14344
UniProt ID Q9JL27
Cytogenetics 7 29.41 cM
Summary This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. provided by RefSeq, Dec 2012
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001271993" in other vectors (1)
SKU Description Size Price
MR229401 Fut2 (myc-DDK-tagged) - Mouse fucosyltransferase 2 (Fut2), transcript variant 1 10 ug
$289.00 $457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.