Fam71f1 (NM_001289663) Mouse Untagged Clone

CAT#: MC227166

Fam71f1 (untagged) - Mouse family with sequence similarity 71, member F1 (Fam71f1), transcript variant 1

USD 330.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fam71f1 (NM_001289663) Mouse Untagged Clone
Symbol Fam71f1
Synonyms GARI-L1; Gm764; NYD-SP18
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC227166 representing NM_001289663
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGACATCAGTTCCACCTAGAAAGTCTTGGTGGACATCGAAGAAGACAGTAAAAGTGATAAGATCAT
ATCCAACCTTCCCTTCCTTGAATGCCTGGGAGAAGTTCAGGGGCCTCTTGCCTGTGGATGGGGAAACGAA
CCCTGGAGTGGGCCTGGGAGTGGAGGAAGGACTACTCTGCCAGATGGTTCATTCTCCAGAATTCAATCTG
TTTCCTAACTCCGTGGTGTTCGAAAGCAACTTTGTTCAGGTCAGAAGGAGCAGAAACTGGAAAGAAATCT
ATAAGGCTTCCAACACAATGGCCCTTGGGGTGACCTCCTCCGTACCTTGCCTTCCCCTTCCGAACATCCT
CCTTATGGCCAGAGTCAAATGGCATCAGGGGCAGAGCCAGACATGGAACAGACCATCCAGAGCGCCAAGC
ATCAACCTGAAGAGCATTCTCCCTTTGAAGTTTGTGGAGCTCCAGATCTGGGACGACCAGGAACGCGTCC
TGCGGTTGAGGACAGTCACCGAGAAAATCTACTATCTGAAGCTCCATCCCGACCACCCTGAGACTGTCTT
CCACTTTTGGATCCGCCTGGTTCAAATTCTGCATAAGGGTCTGTCCATCACCACCAAGGACCCTACCATC
CTTGTCACTCACTGCCTGGTACCCAAGAGCCTTTGCAGCCCAGGTGGAAAGACTGAGTTAGTGCAGAAGA
AATCGAAAGGCCTCCAGCCCAGTGAGAGCCTCACACATCTGATGGCCCAGGGGGAGAGCGAGACCCTCTC
CCAGATCTTTTCCGACTTGCATCAGCAGAAACAGTACAGTTCCAGCAGGAGCGAAAAGATGCACATCAAC
AAGACCAGCTCAGAGAAAGCTACTCCCTGTGAAGACAGCATCCCCTGTACCTGTGATCTCAACTGGAGGG
ATGCATTCATGTTCGGAGAATGGGAAAGAGAAAACCCTTCTGGACCACAGCCCCTCTCACTCCTCGGTAC
TCTGGCTGCCTCCAGCAGGCCACGGCTGTCCCTAACTGGAGGAAACTCTATATGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
Tag Tag Free
ACCN NM_001289663
ORF Size 1035 bp
Insert Size 1035
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289663.1, NP_001276592
RefSeq Size 1596
RefSeq ORF 1035
Locus ID 330277
Cytogenetics 6|6 A3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.