Pbx1 (NM_001291509) Mouse Untagged Clone

CAT#: MC227129

Pbx1 (untagged) - Mouse pre B cell leukemia homeobox 1 (Pbx1), transcript variant d


  "NM_001291509" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pbx1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pbx1
Synonyms 2310056B04Rik; D230003C07Rik; Pbx; Pbx-; Pbx-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227129 representing NM_001291509
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGAGCAGCCGAGGCTGATGCATTCCCACGCTGGGGTCGGGATGGCCGGACACCCCGGCCTGTCCC
AGCACTTGCAGGATGGGGCCGGAGGGACCGAGGGGGAGGGCGGGAGGAAGCAGGACATCGGGGACATTTT
ACAGCAAATTATGACCATCACAGACCAGAGTTTGGATGAAGCGCAGGCCAGAAAACATGCTTTAAACTGC
CACAGAATGAAGCCTGCCTTGTTTAATGTGTTGTGTGAAATCAAAGAAAAAACAGTTTTGAGTATTCGGG
GAGCCCAAGAAGAGGAGCCCACAGACCCCCAGCTCATGCGACTGGACAACATGCTGCTAGCAGAAGGGGT
GGCGGGGCCTGAGAAGGGCGGAGGCTCGGCAGCGGCGGCGGCGGCAGCGGCAGCTTCTGGGGGTGCAGGT
TCAGACAACTCAGTGGAGCATTCCGACTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCACACAG
AGCTGGAGAAGTATGAGCAGGCATGCAATGAATTCACCACCCACGTGATGAACCTCCTTCGAGAGCAAAG
CCGGACCAGGCCCATCTCTCCGAAGGAGATCGAGCGGATGGTGAGCATCATCCACCGCAAGTTCAGCTCC
ATCCAGATGCAGCTGAAACAGAGCACGTGCGAGGCCGTCATGATCCTGCGCTCCCGGTTCCTGGATGCGA
GGCGGAAGAGACGGAATTTCAACAAGCAAGCCACAGAAATTCTGAATGAATATTTCTATTCCCATCTCAG
CAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGCGGCATCACAGTCTCCCAGGTG
GATACCCTTCGCCATGTTATCAGCCAGACAGGAGGATACAGTGACGGACTCGCAGCCAGTCAGATGTACA
GTCCGCAGGGCATCAGTGCTAATGGAGGTTGGCAGGATGCTACTACCCCTTCATCAGTGACCTCCCCTAC
AGAAGGCCCTGGCAGTGTTCACTCTGATACCTCCAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291509
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291509.1, NP_001278438.1
RefSeq Size 6890 bp
RefSeq ORF 1020 bp
Locus ID 18514
Cytogenetics 1 75.95 cM
Gene Summary This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (d) lacks two alternate in-frame exons in the 3' coding region compared to variant a. The encoded isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.