Dlg2 (NM_001243047) Mouse Untagged Clone

CAT#: MC227098

Dlg2 (untagged) - Mouse discs, large homolog 2 (Drosophila) (Dlg2), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dlg2
• Synonyms: A330103J02Rik; B230218P12Rik; B330007M19Rik; Dlgh2; Gm1197; Gm21505; PSD93
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227098 representing NM_001243047
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGAACCACAGCATGAGCTCCGGGTCCGGGTCCCTTCGAACCAATCAGAAACGCTCCCTGTATGTCA
  GAGCCATGTTTGACTATGACAAGAGCAAGGACAGTGGGCTGCCCAGCCAAGGACTTAGTTTTAAATATGG
  AGACATCCTTCATGTCATCAATGCCTCTGATGATGAGTGGTGGCAAGCCAGAAGGGTCACACTAGATGGG
  GACAGCGAGGAGATGGGCGTCATTCCCAGCAAGCGGAGGGTGGAAAGAAAGGAGCGTGCCCGATTGAAGA
  CAGTGAAGTTCAATGCAAAACCTGGTGTGATTGATTCCAAAGGGGACATCCCCGGATTAGGTGACGACGG
  TTATGGAACAAAGACTCTGAGAGGACAAGAAGATCTCATTCTTTCCTATGAACCTGTCACGAGGCAGGAA
  ATAAACTACACGCGGCCAGTGATTATCCTGGGCCCCATGAAGGATCGAATCAATGATGACTTGATATCTG
  AATTTCCTGATAAATTTGGCTCCTGTGTGCCTCATACTACGAGGCCAAAGCGTGACTACGAAGTCGACGG
  CAGAGACTATCACTTTGTCATTTCTAGAGAACAAATGGAGAAAGATATCCAAGAGCACAAATTTATAGAA
  GCTGGCCAGTACAATGACAATTTATACGGAACCAGTGTGCAATCTGTGAGATTTGTAGCAGAAAGGGGCA
  AGCACTGTATACTTGATGTATCAGGAAATGCTATTAAGCGGTTACAAGTCGCCCAGCTCTATCCCATTGC
  CATCTTCATAAAGCCCAAGTCTCTGGAACCTCTGATGGAGATGAATAAGCGTCTGACAGAGGAACAAGCC
  AAGAAAACTTATGACCGGGCGATTAAACTAGAACAAGAATTTGGAGAATATTTTACAGCTATTGTCCAAG
  GAGATACCTTAGAAGATATTTACAACCAATGCAAGCTTGTTATTGAAGAGCAGTCTGGACCTTTCATCTG
  GATTCCCTCAAAGGAGAAGTTATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243047
• Insert Size: 1005 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243047.1, NP_001229976.1
• RefSeq Size: 5933 bp
• RefSeq ORF: 1005 bp
• Locus ID: 23859
• UniProt ID: Q91XM9
• Cytogenetics: 7 51.07 cM
• Gene Summary: Required for perception of chronic pain through NMDA receptor signaling. Regulates surface expression of NMDA receptors in dorsal horn neurons of the spinal cord. Interacts with the cytoplasmic tail of NMDA receptor subunits as well as inward rectifying potassium channels. Involved in regulation of synaptic stability at cholinergic synapses. Part of the postsynaptic protein scaffold of excitatory synapses.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.