Fcer2a (NM_001253739) Mouse Untagged Clone

CAT#: MC227071

Fcer2a (untagged) - Mouse Fc receptor, IgE, low affinity II, alpha polypeptide (Fcer2a), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fcer2a
• Synonyms: CD23; Fce2; Fcer2; Ly-42
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC227071 representing NM_001253739
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACACGCACCATACAGGATACTGGGAACCTCCTAGAAAGCGTTGCTGCTGTGCAAGACGTGGGACAC
  AGCTCATGTTGGTGGGGCTGCTGAGCACAGCAATGTGGGCTGGCCTGCTGGCCCTGCTTCTTCTGTGGCA
  CTGGGAAACGGAGAAGAATCTAAAACAGCTGGGAGACACTGCAATTCAGAATGTCTCTCATGTTACCAAG
  GACTTACAAAAATTCCAGAGTAATCAATTGGCCCAGAAGTCCCAGGTTGTTCAGATGTCACAAAACTTGC
  AAGAACTCCAAGCTGAACAGAAGCAAATGAAAGCTCAGGACTCTCGGCTCTCCCAGAACCTGACCGGACT
  CCAGGAGGATCTAAGGAACGCCCAATCCCAGAACTCAAAACTCTCCCAGAACCTGAACAGACTCCAAGAC
  GATCTAGTCAACATCAAATCCCTGGGCTTGAATGAGAAGCGCACAGCCTCCGATTCTCTAGAGAAACTCC
  AGGAAGAGGTGGCAAAGCTGTGGATAGAGATACTGATTTCAAAGGGAACTGCATGCAACATATGTCCCAA
  GAACTGGCTCCATTTCCAACAGAAGTGCTACTATTTTGGCAAGGGCTCCAAGCAGTGGATCCAGGCCAGG
  TTCGCCTGCAGTGACCTGCAAGGGCGACTAGTCAGCATCCACAGCCAAAAGGAACAGGACTTCCTGATGC
  AACACATCAACAAGAAGGATTCCTGGATTGGCCTCCAGGATCTCAATATGGAGGGAGAGTTTGTATGGTC
  GGACGGGAGCCCTGTGGGTTATAGCAACTGGAATCCAGGGGAGCCCAATAACGGGGGCCAGGGTGAGGAC
  TGTGTGATGATGCGGGGATCCGGCCAGTGGAACGACGCCTTCTGCCGCAGCTACTTGGATGCATGGGTGT
  GTGAGCAGCTGGCAACATGTGAGATATCTGCCCCCTTAGCCTCTGTGACTCCAACAAGGCCCACCCCAAA
  AAGTGAACCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253739
• Insert Size: 993 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253739.1, NP_001240668.1
• RefSeq Size: 2111 bp
• RefSeq ORF: 993 bp
• Locus ID: 14128
• UniProt ID: P20693
• Cytogenetics: 8 1.92 cM
• Gene Summary: Low-affinity receptor for immunoglobulin E (IgE) and CR2/CD21. Has essential roles in the regulation of IgE production and in the differentiation of B-cells (it is a B-cell-specific antigen).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) has a different 5' end with an alternate start codon, compared to variant 1. The resulting protein (isoform C) has a shorter and distinct N-terminus when it is compared to isoform A. Although variants 2 and 3 encode a protein of the same length (330 aa), the sequence of the two proteins (isoform B and isoform C) are different. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.