Trex1 (NM_001012236) Mouse Untagged Clone

CAT#: MC226976

Trex1 (untagged) - Mouse three prime repair exonuclease 1 (Trex1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Trex1
• Synonyms: AU041952
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226976 representing NM_001012236
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCTCACAGACCCTGCCCCATGGTCACATGCAGACCCTCATCTTCTTAGACCTGGAAGCCACTGGCC
  TGCCTTCGTCTCGGCCCGAAGTCACAGAGCTGTGCCTGCTGGCTGTCCACAGACGTGCTCTGGAGAACAC
  TTCCATTTCTCAGGGACATCCACCTCCAGTGCCCAGACCGCCCCGTGTGGTGGACAAGCTCTCTCTGTGC
  ATTGCTCCAGGGAAAGCCTGTAGCCCTGGGGCCAGTGAGATCACAGGTCTGAGCAAAGCTGAGCTGGAAG
  TACAGGGGCGTCAACGCTTCGATGACAACCTGGCCATCCTGCTCCGAGCCTTCCTGCAGCGCCAGCCACA
  GCCTTGCTGCCTTGTGGCACACAACGGTGACCGCTATGACTTTCCTCTGCTCCAGACAGAGCTTGCTAGG
  CTGAGCACTCCCAGTCCCCTAGATGGTACCTTCTGTGTGGACAGCATCGCTGCCCTAAAGGCCTTGGAAC
  AAGCTAGCAGCCCCTCAGGGAATGGTTCGAGGAAAAGCTACAGCCTGGGCAGCATCTACACCCGCCTGTA
  CTGGCAAGCACCGACAGACTCACATACTGCTGAAGGTGATGTTCTAACCCTGCTCAGCATCTGTCAGTGG
  AAGCCACAGGCCCTACTGCAGTGGGTGGACGAACATGCCCGGCCCTTTAGCACCGTCAAGCCCATGTACG
  GCACTCCGGCTACCACTGGAACAACCAACCTAAGGCCACATGCTGCCACAGCTACTACACCCCTGGCCAC
  AGCCAATGGAAGTCCCAGCAATGGCAGGAGCAGGCGACCTAAGAGTCCTCCTCCAGAGAAGGTCCCAGAA
  GCCCCATCACAGGAGGGGCTGCTGGCCCCACTGAGCCTGCTGACCCTCCTGACCTTGGCAATAGCCACTC
  TGTATGGACTCTTCCTGGCCTCACCTGGGCAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012236
• Insert Size: 945 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012236.1, NP_001012236.1
• RefSeq Size: 1060 bp
• RefSeq ORF: 945 bp
• Locus ID: 22040
• UniProt ID: Q91XB0
• Cytogenetics: 9 F2
• Gene Summary: Major cellular 3'-to-5' DNA exonuclease which digests single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with mismatched 3' termini. Prevents cell-intrinsic initiation of autoimmunity. Acts by metabolizing DNA fragments from endogenous retroelements, including L1, LTR and SINE elements. Unless degraded, these DNA fragments accumulate in the cytosol and activate the IFN-stimulatory DNA (ISD) response and innate immune signaling. Prevents chronic ATM-dependent checkpoint activation, by processing ssDNA polynucleotide species arising from the processing of aberrant DNA replication intermediates. Inefficiently degrades oxidized DNA, such as that generated upon antimicrobial reactive oxygen production or upon absorption of UV light. During GZMA-mediated cell death, contributes to DNA damage in concert with NME1. NME1 nicks one strand of DNA and TREX1 removes bases from the free 3' end to enhance DNA damage and prevent DNA end reannealing and rapid repair.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.