Pex2 (NM_001267715) Mouse Untagged Clone

CAT#: MC226922

Pex2 (untagged) - Mouse peroxisomal biogenesis factor 2 (Pex2), transcript variant 9

USD 299.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pex2 (NM_001267715) Mouse Untagged Clone
Symbol Pex2
Synonyms D3Ertd138e; PAF-1; PMP35; Pxmp3
Vector pCMV6-Entry
Sequence Data
>MC226922 representing NM_001267715
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGGCAAAGAAGAGAATATGCAGAGTGCAAACAGAGTGCTGAGGATAAGTCAGTTGGATGCACTTG
AACTGAATAAGGCCCTGGAGCAGCTTGTGTGGTCCCAGTTTACTCAGTGCTTTCATGGATTTAAGCCAGG
ACTGTTAGCTCGCTTTGAGCCAGAAGTGAAAGCATTTCTGTGGCTTTTCCTATGGAGGTTCACCATCTAC
TCCAAAAATGCCACTGTGGGGCAGTCAGTTTTAAATATTCAGTACAAAAATGATTCTTCTCTCAACCTGA
TATACCAGCCACCGAGTAAAACTCAGAAACTGTGGTATGCTGTGTGCACCATTGGGGGAAAGTGGTTAGA
AGAACGATGTTATGATTTGTTTCGAAACCGTCATTTAGCGTCTTTTGGGAAAGCCAAACAGTTCATGAAT
TTTCTGGTTGGACTTTTAAAATTAGGTGAGTTGATAAACTTCTTGATTTTCCTACAAAAGGGAAAGTTTG
CAACTTTGACAGAACGCCTCCTTGGCATTCATTCCGTATTTTGCAAGCCCCAGAACATGCGCGAAGTTGG
CTTTGAGTACATGAATAGGGAACTTCTCTGGCATGGCTTTGCTGAGTTTCTGATTTTTCTCTTACCACTT
ATCAATATCCAGAAGTTGAAAGCCAAATTGTCTTCCTGGTGTATCCCTCTTACTGGTGCTGCTGGTCATG
ACAGTACACTAGGCAGCAGTGGAAAAGAGTGTGCTCTGTGTGGAGAGTGGCCCACAATGCCTCACACTAT
TGGATGTGAACATGTATTTTGTTACTACTGTGTTAAGAGTAGCTTCCTATTTGACATATACTTTACGTGC
CCGAAGTGTGGCACAGAAGTGCACAGTGTGCAGCCCTTGAAATCAGGAATTGAAATGTCAGAAGTAAATG
CTCTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001267715
ORF Size 918 bp
Insert Size 918
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001267715.1, NP_001254644
RefSeq Size 2006
RefSeq ORF 918
Locus ID 19302
Cytogenetics 3 A1|3 1.96 cM
Gene Summary Somewhat implicated in the biogenesis of peroxisomes. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.