Cadps2 (NM_001252109) Mouse Untagged Clone

CAT#: MC226911

Cadps2 (untagged) - Mouse Ca2+-dependent activator protein for secretion 2 (Cadps2), transcript variant 6

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cadps2
• Synonyms: A230044C21Rik; Caps-2; Caps2; Cpd2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226911 representing NM_001252109
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTCGACCCGTCTTCCAGCGAGGAGGAGTCGGACGAGGGGCTGGAGGAGGAGAGCCGCGAGGTGTTGG
  TGGCGCCGGGCGTCTCCCAGCGAGCGCCGCCGGCCGCGGCTCGGGAAGGGCGGCGGGACGCGCCGGGACG
  CTCCGGTGGTGGCAGCGGCGGCGGAGCGGCCAGACCCGTGAGCCCGAGCCCCTCGGTACTCAGCGAGGGG
  CGAAATGAGCCCGAGCTGCAGCTGGACGAGGAGCAGGAGCGGCGCATCCGCCTGCAGCTCTACGTCTTCG
  TGGTGAGGTGCATCGCGTACCCATTCAACGCCAAGCAGCCCACCGACATGGCCCGGAGGCAGCAGAAGCT
  TAACAAACAACAATTGCAGTTACTGAAAGAACGGTTCCAGGCCTTTCTCAATGGAGAAACTCAGATAGTA
  GCAGACGAAGCCTTCTGCAATGCCGTCCGGAGTTACTATGAGGTGTTTCTAAAGAGTGACCGTGTGGCCA
  GAATGGTTCAAAGTGGAGGATGCTCTGCTAATGATTTCAGAGAGGTGTTTAAGAAGAACATAGAAAAACG
  TGTCCGTAGCCTGCCAGAGATAGATGGCCTGAGCAAAGAGACAGTGCTGAGCTCATGGATAGCCAAATAT
  GACGCCATTTACAGGGGAGAAGAAGATTTGTGCAAACAGCCGAACAGGATGACCCTCAGTGCCGTGTCTG
  AGCTTATTCTGAGTAAGGAGCAGCTCTATGAAATGTTCCAGCAGATTCTGGGCATTAAGAAGCTGGAACA
  CCAGCTACTTTATAACGCATGCCAGCTGGATAACGCTGATGAACAAGCAGCCCAGATCAGAAGGGAACTT
  GATGGCCGCCTGCAGTTGGCAGAGAAGATGGCAAAGGATCTTGCTATAGCCAAGGGTAACCTCAAAGAGT
  AA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252109
• Insert Size: 912 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252109.1, NP_001239038.1
• RefSeq Size: 1512 bp
• RefSeq ORF: 912 bp
• Locus ID: 320405
• Cytogenetics: 6 A3.1
• Gene Summary: Calcium-binding protein involved in exocytosis of vesicles filled with neurotransmitters and neuropeptides. Probably acts upstream of fusion in the biogenesis or maintenance of mature secretory vesicles. Regulates neurotrophin release from granule cells leading to regulate cell differentiation and survival during cerebellar development. May specifically mediate the Ca(2+)-dependent exocytosis of large dense-core vesicles (DCVs) and other dense-core vesicles.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (6) lacks several exons in the central and 3' coding regions, but includes an alternate 3' exon and thus differs in its 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (6, also known as CAPS2f) has a distinct and significantly shorter C-terminus, compared to isoform 1.