Hoxa9 (NM_001277238) Mouse Untagged Clone

CAT#: MC226863

Hoxa9 (untagged) - Mouse homeobox A9 (Hoxa9), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hoxa9
• Synonyms: D6a; D6a9; Hox-1.; Hox-1.7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226863 representing NM_001277238
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTTTTGCTATAAAAATTATGACTGCAAAACACCGGGCCATTAATAGCGTGCGGAGTGATTTACGCG
  TTATTGTTCTGCCGGGCGGACACGTGACGCGCGTGGCCAATGGGGGCGCGGGCGCCGGCAACTTATTAGG
  TGACTGTACTTCACCCCCCCCTGGTGCCACCAAGTTGTTACATGAAATCTGCAGTTTCATAATTTCGGCG
  GGTCGGGCTGGGCCGGCCAGGCGCGGGCTACTGCAATGGCCACCACCGGGGCCCTGGGCAACTACTATGT
  GGACTCCTTCCTGCTGGGCGCCGACGCTGCTGATGAGCTGGGTGCGGGACGCTACGCTCCAGGGACCCTG
  GGTCAACCCCCAAGGCAGGCGGCAGCTCTGGCCGAACACCCCGACTTCAGTCCTTGCAGCTTCCAGTCCA
  AGGCGGCGGTGTTTGGTGCCTCGTGGAACCCAGTGCACGCGGCGGGCGCCAATGCGGTGCCTGCTGCAGT
  GTATCATCACCACCACCACCCCTACGTGCATCCCCAGGCGCCCGTGGCGGCGGCGGCGCCGGACGGCAGT
  TGATAGAGAAAAACAACCCAGCGAAGGCGCCTTCTCCGAAAACAATGCCGAGAATGAGAGCGGCGGAGAC
  AAGCCCCCCATCGATCCCAATAACCCGGCTGCCAACTGGCTACATGCTCGCTCCACTCGGAAGAAGCGAT
  GCCCCTACACAAAACACCAGACGCTGGAACTGGAGAAGGAGTTTCTGTTTAACATGTACCTCACACGGGA
  CCGCAGGTACGAGGTGGCCCGGCTGCTCAACCTCACCGAAAGGCAGGTCAAGATCTGGTTCCAGAACCGC
  AGGATGAAAATGAAGAAAATCAACAAGGACCGAGCAAAAGACGAGTGA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001277238
• Insert Size: 888 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001277238.1, NP_001264167.1
• RefSeq Size: 3056 bp
• RefSeq ORF: 888 bp
• Locus ID: 15405
• Cytogenetics: 6 25.4 cM
• Gene Summary: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of similar genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is important for hematopoeisis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (2) lacks an internal segment in the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is longer than isoform 1. The exon structure of this variant is similar to Hoxa9T (PMID: 9524228). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.