March1 (NM_001293784) Mouse Untagged Clone

CAT#: MC226809

42064 (untagged) - Mouse membrane-associated ring finger (C3HC4) 1 (March1), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: March1
• Synonyms: 2900024D24Rik; BB085186
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226809 representing NM_001293784
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGGGCTGGTGTGAAGCGATAGCCCGTAACCCTCACAGAATCCCAAACACCACGCGGACACCAGAGA
  CCTCAGGGGATGTGGCCGATGCCTCTCAAACCTCCACGCTGAATGAAAAGTCCCCAGGGCGATCTGCAAG
  TCGATCAAGTAACATATCAAAAGCAAGCAGCCCAACGACAGGGACAGCTCCCAGGAGCCAGTCAAGGTTG
  TCTGTCTGTCCATCTACTCAGGACATCTGCAGGATCTGTCACTGCGAAGGAGATGAAGAGAGCCCACTCA
  TCACACCCTGTCGCTGCACAGGAACCTTGCGCTTTGTCCACCAGTCCTGCCTCCACCAATGGATCAAGAG
  CTCAGACACACGATGCTGTGAGCTCTGCAAGTATGACTTCATAATGGAGACCAAGCTCAAGCCCCTTCGG
  AAGTGGGAAAAGCTCCAGATGACCACGAGCGAAAGGAGGAAAATATTCTGCTCTGTCACGTTCCACGTCA
  TCGCCGTCACCTGTGTGGTGTGGTCCTTGTATGTGTTGATAGATCGGACAGCGGAGGAAATCAAGCAAGG
  TAACGACAATGGTGTGCTGGAATGGCCATTTTGGACAAAACTGGTTGTGGTGGCTATTGGCTTCACGGGA
  GGTCTCGTCTTCATGTATGTACAGTGTAAAGTCTACGTCCAACTGTGGCGCCGGCTGAAGGCCTACAACC
  GTGTGATCTTTGTGCAGAATTGCCCAGACACTGCCAACAAACTGGAGAAGAACTTCCCGTGTAATGTGAA
  CACGGAAATCAAGGATGCTGTGGTTGTGCCTGTGCCACAGACAGGTTCAAATACACTGCCAACTGCAGAG
  GGAGCCCCACCTGAGGTTATACCAGTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293784
• Insert Size: 870 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293784.1, NP_001280713.1
• RefSeq Size: 4444 bp
• RefSeq ORF: 870 bp
• Locus ID: 72925
• UniProt ID: Q6NZQ8
• Cytogenetics: 8 B3.1
• Gene Summary: E3 ubiquitin-protein ligase that mediates ubiquitination of TFRC, CD86, FAS and MHC class II proteins, such as HLA-DR alpha and beta, and promotes their subsequent endocytosis and sorting to lysosomes via multivesicular bodies. By constitutively ubiquitinating MHC class II proteins in immature dendritic cells, down-regulates their cell surface localization thus sequestering them in the intracellular endosomal system.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) represents the longest transcript and encodes the longest isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.