Gjb1 (NM_001302498) Mouse Untagged Clone

CAT#: MC226779

Gjb1 (untagged) - Mouse gap junction protein, beta 1 (Gjb1), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gjb1
• Synonyms: Cnx32; connex; connexin-32; Cx32; Cxng
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226779 representing NM_001302498
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACTGGACAGGTCTATACACCTTGCTCAGTGGCGTGAATCGGCACTCTACAGCCATTGGCCGAGTAT
  GGCTGTCTGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCTGAGAGCGTGTGGGGGGATGA
  GAAGTCCTCTTTCATCTGTAACACCCTCCAGCCGGGCTGCAACAGCGTCTGCTATGACCATTTTTTCCCC
  ATCTCCCACGTGCGCCTATGGTCCCTGCAGCTTATCTTGGTTTCCACCCCAGCTCTCCTCGTGGCAATGC
  ACGTAGCTCACCAACAGCACATAGAAAAGAAAATGCTACGGCTTGAGGGGCATGGGGACCCCCTTCACCT
  GGAAGAGGTAAAGAGACACAAGGTGCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGTGTGGTG
  TTCCGGCTGCTGTTCGAGGCTGTCTTCATGTATGTCTTCTATCTGCTCTACCCCGGCTATGCCATGGTGC
  GGCTGGTCAAGTGTGAAGCCTTCCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCCACCGAGAA
  AACCGTCTTCACTGTCTTTATGCTCGCAGCCTCCGGCATCTGCATTATCCTCAACGTGGCGGAGGTGGTG
  TACCTCATCATCCGGGCCTGTGCCCGCCGTGCTCAGCGCCGCTCCAATCCGCCCTCCCGCAAGGGCTCGG
  GCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGCGAGCAGGATGG
  CTCTCTGAAAGACATACTGCGCCGCAGCCCTGGCACAGGGGCCGGGCTCGCTGAAAAGAGCGACCGATGC
  TCAGCCTGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302498
• Insert Size: 852 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302498.1, NP_001289427.1
• RefSeq Size: 1546 bp
• RefSeq ORF: 852 bp
• Locus ID: 14618
• UniProt ID: P28230
• Cytogenetics: X 44.06 cM
• Gene Summary: This gene is a member of the gap junction protein (connexin) family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of ions and small molecules between cells. Mutations in a similar gene in human cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Oct 2014]
  Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All of the variants encode the same protein.