Akt1s1 (NM_001290694) Mouse Untagged Clone

CAT#: MC226776

Akt1s1 (untagged) - Mouse AKT1 substrate 1 (proline-rich) (Akt1s1), transcript variant 3

USD 279.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Akt1s1 (NM_001290694) Mouse Untagged Clone
Symbol Akt1s1
Synonyms 1110012J22Rik; AI227026; Lobe; Lobel; PRAS40
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC226776 representing NM_001290694
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACGCAAGAAGCCGCCATGCCTTTTGAGGGCGGCGACGGCGCCTGGCCGGCCATGCTGGCTACGGGCA
CGGCTCGGATGGCGTCTGGGCGGCCAGAGGAACTGTGGGAAGCCGTCGTGGGGGCCGCCGAGCGCTTTCA
GGCCCGCACTGGCACAGAGCTGGTATTACTGACTGCAGCGCCACCGCCGCCGCCCCGCCCTGGACCCTGT
GCCTATGCCGCCCATGGCCGCGGAGCCCTGGCAGAGGCGGCCCGACGCTGCCTCCACGACATCGCACAGG
CGCACAGGGCTGCCACTGCCACCCGACCTCCTGGTCCCCCACCAGCACCACAGCCGCCCAGCCCTGCTCC
TAGTCCACCACCTCGGCCAGCCCTGGCCAGGGAGGATGAGGAGGAAGATGAGGACGAGCCCACTGAAACA
GAGACATCTGGGGAGCGGCTGGGCGGTAGCGATAATGGAGGTCTCTTCATGATGGATGAGGATGCCACCC
TCCAGGACCTGCCCCCCTTCTGCGAGTCAGACCCGGAGAGCACAGACGACGGCAGCCTGAGCGAGGAGAC
GCCCGCCGGTCCCACAGCCTGTCCCCAGCCCCCGGCCACAGCCCTGCCTACCCAGCAGTATGCCAAGTCT
CTGCCCGTGTCGGTGCCAGTGTGGGCCTTCAAGGAGAAGAGGACAGAAGCCCGATCGTCAGATGAGGAGA
ATGGCCCGCCCTCCTCGCCCGACCTAGACCGAATAGCGGCCAGCATGCGCGCGCTGGTGCTGCGGGAGGC
TGAGGACACCCAGGTCTTCGGGGATCTTCCGCGGCCGCGGCTCAATACCAGCGACTTCCAGAAGCTGAAG
CGGAAATATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001290694
ORF Size 852 bp
Insert Size 852
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001290694.1, NP_001277623
RefSeq Size 1857
RefSeq ORF 852
Locus ID 67605
Cytogenetics 7|7 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.