Npr3 (NM_001286395) Mouse Untagged Clone

CAT#: MC226759

Npr3 (untagged) - Mouse natriuretic peptide receptor 3 (Npr3), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Npr3
• Synonyms: ANP-C; ANPR-C; EF-2; lgj; NPR-C; stri
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226759 representing NM_001286395
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTGTGCCAGTGGTGACACCATTCGGAGAATCATGTTGGCGGTGCACAGACACGGCATGACCAGTGGAG
  ACTACGCTTTCTTCAACATTGAACTCTTCAACAGTTCTTCCTACGGAGATGGCTCGTGGAGGAGAGGAGA
  CAAACACGACTCTGAAGCTAAACAAGCATACTCGTCCCTCCAAACAGTCACCCTACTGAGGACCGTGAAA
  CCTGAGTTTGAGAAGTTTTCCATGGAGGTGAAAAGTTCTGTTGAGAAACAAGGGCTCAATGAGGAGGATT
  ACGTGAACATGTTTGTTGAAGGGTTCCATGACGCCATCCTCCTCTACGTTCTGGCTTTACATGAAGTACT
  CAGAGCTGGCTACAGCAAGAAGGATGGGGGGAAAATCATCCAGCAGACTTGGAACAGGACATTTGAAGGT
  ATCGCCGGGCAGGTGTCCATAGATGCCAACGGGGACCGGTATGGGGACTTCTCTGTGGTTGCCATGACTG
  ACACTGAAGCAGGCACCCAAGAGGTCATTGGTGATTACTTTGGGAAAGAAGGCCGGTTCCAAATGCGATC
  GAATGTCAAATATCCTTGGGGCCCTTTGAAACTGAGACTAGATGAGACCAGAATCGTGGAGCATACCAAC
  AGCTCTCCTTGCAAATCATGTGGCCTAGAAGAATCTGCAGTGACAGGAATCGTTGTGGGGGCCCTACTAG
  GTGCTGGCTTGCTAATGGCCTTCTACTTTTTCAGGAAGAAATACAGAATAACCATTGAGAGGCGAAATCA
  GCAAGAGGAAAGCAACATCGGGAAGCATCGAGAGCTGCGAGAAGATTCCATCAGATCACATTTTTCGGTG
  GCTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286395
• Insert Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286395.1, NP_001273324.1
• RefSeq Size: 6540 bp
• RefSeq ORF: 846 bp
• Locus ID: 18162
• Cytogenetics: 15 5.83 cM
• Gene Summary: Receptor for the natriuretic peptide hormones, binding with similar affinities atrial natriuretic peptide NPPA/ANP, brain natriuretic peptide NPPB/BNP, and C-type natriuretic peptide NPPC/CNP (PubMed:10377427, PubMed:17951249). May function as a clearance receptor for NPPA, NPPB and NPPC, regulating their local concentrations and effects (PubMed:10377427, PubMed:17951249). May regulate diuresis, blood pressure and skeletal development (PubMed:10377427). Does not have guanylate cyclase activity (PubMed:10377427).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks part of the 5' coding region, uses an alternate in-frame splice site in the 3' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (c) is shorter, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.