Fhl2 (NM_001289533) Mouse Untagged Clone

CAT#: MC226747

Fhl2 (untagged) - Mouse four and a half LIM domains 2 (Fhl2), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fhl2
• Synonyms: FHL-2; SL; SLIM-3; SLIM3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226747 representing NM_001289533
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACTGAACGCTTTGACTGCCACCACTGCAATGAATCTCTGTACGGCAAGAAGTACATTCTAAAGGAGG
  AGAACCCACACTGTGTGGCCTGCTTTGAGGAACTCTATGCCAATACCTGTGAGGAGTGTGGAACACCCAT
  CGGCTGCGACTGCAAGGACTTGTCCTACAAGGATCGGCACTGGCATGAAGGCTGCTTCCATTGCTCCCGG
  TGTGGAAGCTCGCTGGTGGACAAGCCCTTTGCTGCCAAGGAGGAACAGCTGCTGTGCACCGACTGCTATT
  CCAATGAATACTCGTCCAAGTGCCAGGAATGCAAGAAAACCATCATGCCAGGTACCCGCAAGATGGAATA
  CAAGGGCAGCAGCTGGCACGAGACCTGCTTCACCTGTCAGCGCTGCCAGCAGCCCATTGGAACCAAGAGC
  TTCATACCTAAGGAGAATCAGAACTTCTGCGTGCCCTGCTATGAGAAGCAGTATGCCCTGCAGTGCGTGC
  AGTGCAAAAAGCCTATCACCACAGGAGGTGTTACTTACCGGGAGCAGCCCTGGCACAAGGAATGCTTTGT
  GTGCACAGCCTGCAAGAAGCAGCTATCTGGGCAACGCTTCACAGCACGGGATGAGTTTCCATACTGCCTG
  ACCTGCTTCTGTGACTTGTACGCTAAGAAATGTGCTGGGTGCACCAACCCCATTAGTGGTCTGGGTGGCA
  CAAAGTACATCTCTTTCGAGGAACGCCAATGGCACAACGACTGCTTTAACTGTAAGAAGTGCTCCCTGTC
  TCTGGTGGGACGAGGCTTCCTCACAGAGAGAGATGACATCCTCTGTCCTGACTGTGGAAAGGATATTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289533
• Insert Size: 840 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289533.1, NP_001276462.1
• RefSeq Size: 1417 bp
• RefSeq ORF: 840 bp
• Locus ID: 14200
• UniProt ID: O70433
• Cytogenetics: 1 C1.1
• Gene Summary: This gene encodes a member of the four-and-a-half-LIM-only protein family. The encoded protein functions as a regulator in numerous signaling pathways and cellular processes in development and cellular differentiation, including development and maintenance of the cardiovascular system and striated muscles. This gene also plays a role in bone formation and regulates and bone mineral content and bone mineral density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.