Set (NM_001204875) Mouse Untagged Clone

CAT#: MC226741

Set (untagged) - Mouse SET nuclear oncogene (Set), transcript variant 2


  "NM_001204875" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Set
Synonyms 2610030F17Rik; 5730420M11Rik; AA407739; I-2PP2A; StF-IT-1; TAF-I
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226741 representing NM_001204875
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGCGCCGACGGCCAAAGCCAGTAAAAAGGAGCTCAACTCCAATCACGACGGGGCCGACGAGACCT
CAGAAAAAGAACAGCAAGAAGCAATTGAACATATTGATGAAGTACAAAATGAAATAGACAGACTTAATGA
ACAAGCCAGTGAGGAAATTTTGAAAGTAGAACAAAAATATAACAAACTCCGCCAACCATTTTTTCAGAAG
AGGTCAGAATTGATCGCCAAAATCCCAAATTTTTGGGTAACAACATTTGTCAACCATCCACAAGTGTCTG
CACTGCTTGGGGAGGAGGACGAGGAGGCTCTGCATTATTTGACCAGAGTTGAAGTGACAGAATTTGAAGA
CATTAAATCAGGTTACAGAATAGATTTTTATTTTGATGAAAATCCTTACTTTGAAAATAAAGTTCTCTCC
AAAGAATTTCATCTGAACGAGAGTGGTGACCCGTCTTCAAAGTCCACCGAAATCAAATGGAAATCTGGAA
AGGATTTGACAAAACGCTCAAGTCAAACGCAAAATAAGGCCAGCAGGAAGAGGCAGCACGAAGAGCCAGA
GAGCTTCTTTACCTGGTTTACTGACCATTCTGACGCAGGTGCTGATGAGTTAGGAGAGGTCATCAAAGAT
GACATCTGGCCAAATCCCTTGCAGTACTACCTGGTTCCCGACATGGATGATGAAGAAGGAGAGGCAGAAG
ATGATGATGACGACGACGAAGAGGAGGAGGGGCTGGAAGATATTGATGAAGAAGGAGATGAGGATGAAGG
TGAAGAAGATGACGATGAGGATGAAGGGGAGGAAGGAGAGGAGGACGAAGGCGAGGATGATTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001204875
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204875.1, NP_001191804.1
RefSeq Size 2833 bp
RefSeq ORF 834 bp
Locus ID 56086
UniProt ID Q9EQU5
Cytogenetics 2 B
Gene Summary Multitasking protein, involved in apoptosis, transcription, nucleosome assembly and histone chaperoning. Isoform 2 anti-apoptotic activity is mediated by inhibition of the GZMA-activated DNase, NME1. In the course of cytotoxic T-lymphocyte (CTL)-induced apoptosis, GZMA cleaves SET, disrupting its binding to NME1 and releasing NME1 inhibition. Isoform 1 and isoform 2 are potent inhibitors of protein phosphatase 2A. Isoform 1 and isoform 2 inhibit EP300/CREBBP and PCAF-mediated acetylation of histones (HAT) and nucleosomes, most probably by masking the accessibility of lysines of histones to the acetylases. The predominant target for inhibition is histone H4. HAT inhibition leads to silencing of HAT-dependent transcription and prevents active demethylation of DNA. Both isoforms stimulate DNA replication of the adenovirus genome complexed with viral core proteins; however, isoform 2 specific activity is higher (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) encodes the shorter isoform (2; also known as isoform beta).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.