Casp3 (NM_001284409) Mouse Untagged Clone

SKU
MC226736
Casp3 (untagged) - Mouse caspase 3 (Casp3), transcript variant 1
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Casp3
Synonyms A830040C14Rik; AC-; AC-3; Casp; CASP-3; Caspase-3; CC3; CPP; CPP-32; CPP32; Lice; mld; mldy; SCA-1; Ya; Yama
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226736 representing NM_001284409
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAACAACAAAACCTCAGTGGATTCAAAATCCATTAATAATTTTGAAGTAAAGACCATACATGGGA
GCAAGTCAGTGGACTCTGGGATCTATCTGGACAGTAGTTACAAAATGGATTATCCTGAAATGGGCATATG
CATAATAATTAATAATAAGAACTTCCATAAGAGCACTGGAATGTCATCTCGCTCTGGTACGGATGTGGAC
GCAGCCAACCTCAGAGAGACATTCATGGGCCTGAAATACCAAGTCAGGAATAAAAATGATCTTACTCGTG
AAGACATTTTGGAATTAATGGATAGTGTTTCTAAGGAAGATCATAGCAAAAGGAGCAGCTTTGTGTGTGT
GATTCTAAGCCATGGTGATGAAGGGGTCATTTATGGGACAAATGGGCCTGTTGAACTGAAAAAGTTGACT
AGCTTCTTCAGAGGCGACTACTGCCGGAGTCTGACTGGAAAGCCGAAACTCTTCATCATTCAGGCCTGCC
GGGGTACGGAGCTGGACTGTGGCATTGAGACAGACAGTGGGACTGATGAGGAGATGGCTTGCCAGAAGAT
ACCGGTGGAGGCTGACTTCCTGTATGCTTACTCTACAGCACCTGGTTACTATTCCTGGAGAAATTCAAAG
GACGGGTCGTGGTTCATCCAGTCCCTTTGCAGCATGCTGAAGCTGTACGCGCACAAGCTAGAATTTATGC
ACATTCTCACTCGCGTTAACAGGAAGGTGGCAACGGAATTCGAGTCCTTCTCCCTGGACTCCACTTTCCA
CGCAAAGAAACAGATCCCGTGTATTGTGTCCATGCTCACGAAAGAACTGTACTTTTATCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001284409
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001284409.1, NP_001271338.1
RefSeq Size 2610 bp
RefSeq ORF 834 bp
Locus ID 12367
UniProt ID P70677
Cytogenetics 8 26.39 cM
Summary This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001284409" in other vectors (1)
SKU Description Size Price
MR228947 Casp3 (myc-DDK-tagged) - Mouse caspase 3 (Casp3), transcript variant 1 10 ug
$289.00 $300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.