Naxd (NM_001293661) Mouse Untagged Clone

CAT#: MC226716

Carkd (untagged) - Mouse carbohydrate kinase domain containing (Carkd), transcript variant 3


  "NM_001293661" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Naxd"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Naxd
Synonyms 0710008K08Rik; 2810407E01Rik; Carkd
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226716 representing NM_001293661
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGTCCGCTGTGTGGCAATCCGCGCCTGCGGGGGAGTTTTACAGAGAGCACTGTCTCTCCATACAG
CACATGCGACAAAGGACATGGAGAACCTTTTTCAGCTGGTGAGAAACATTGTGCCTGCTCTGACGTCGAA
GAAGCACAAGGGGCAAGATGGAAGAATAGGCATAGTCGGGGGCTGCCAAGAGTACACAGGAGCACCATAT
TTTGCAGGAATCTCAGCCTTGAAAGTGGGTGCAGATTTGACCCACGTGTTCTGTGCCAGGGAGGCAGCGC
CAGTGATCAAGTCCTACAGCCCAGAGCTGATCGTCCACCCAGTCCTTGACAGTTCCAATGCTGTTGAGGA
GGTGGAGAAATGGCTCCCCAGGCTGCATGCCCTTGTCGTGGGACCTGGCCTAGGTAGGGATGACCTTCTT
CTCAACAATGTCAGGGGCATTTTGGAATCAACCAAGGCCAGGGACATCCCTGTGGTCATTGATGCGGACG
GCCTGTGGCTCGTTGCTCAGCAGCCAGCCCTCATCCATAGTTACCACAAGGCCATTCTCACCCCCAACCA
CGTGGAGTTCAGCAGACTCTGGGAAGCTGTGCTCAGTAGTCCTATGGACAGCAACGATCTCAAGGGCTCC
ACACTGAAGCTCAGCCAGGCCCTGGGGAACATCACAGTGGTCCAGAAAGGAGAGCAGGACCTGATCTCCA
ATGGCCAGCAGGCTCCAGCCCACTCCTGGTGGCTGCCTGGGGCGCCTGCACACTCACAAGGGAGTGTAAC
CGGCAGGCCTTCCAGAAGTACGGGCGCTCTACAACCACTACCGACATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293661
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293661.1, NP_001280590.1
RefSeq Size 1209 bp
RefSeq ORF 819 bp
Locus ID 69225
Cytogenetics 8 A1.1
Gene Summary Catalyzes the dehydration of the S-form of NAD(P)HX at the expense of ATP, which is converted to ADP. Together with NAD(P)HX epimerase, which catalyzes the epimerization of the S- and R-forms, the enzyme allows the repair of both epimers of NAD(P)HX, a damaged form of NAD(P)H that is a result of enzymatic or heat-dependent hydration.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate in-frame exon in the 5' UTR and 5' coding region and lacks an alternate coding exon in the 3' end compared to variant 1. This results in a shorter protein (isoform 2) with distinct N- and C-termini compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.