Phyhd1 (NM_001252571) Mouse Untagged Clone

CAT#: MC226708

Phyhd1 (untagged) - Mouse phytanoyl-CoA dioxygenase domain containing 1 (Phyhd1), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Phyhd1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226708 representing NM_001252571
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTGCCTGAGTCCCTCACAACTCAAGAAGTTCCAGGAGGACGGGTTTCTGCTGTTGGAAGGATTCT
  TCACAGCGGATGAGTGTGTGGCCATGCAGCAGAGGATCGGTGAGATTGTAGCTGAGATGGATGTCCCTCT
  GCACTGCCGGACAGAATTTTCCACCCAGGAAGATGAGCAACTTCAAACCCAGGGCAAGACAGACTACTTC
  TTGAGCAGCGGTGACAAGATCCGATTCTTCTTTGAAAAAGGCGTTTTTGATGAGAAAGGAAATTTCTTGG
  TCCCTCCTGAGAAATCTATCAACAAAATTGGCCATGCTCTGCATGCCCATGACCCTGTCTTCAGGAGCAT
  CACACATTCTCCCAAGGTGCAGCAACCTCACTTTGGCGGCGAAGTCTCCCCTCACCAGGATGCTACCTTC
  CTCTACACGGAGCCCCTAGGCCGAGTGTTGGGCCTGTGGATTGCGATGGAGGATGCCATGCTGGAGAACG
  GTTGCCTCTGGTTCATCCCTGGCTCCCATACCCGTGGGGTGTCAAGAAGGATGATTCGAGCCCCTTCAGA
  CTCTGGGCCTGGCACCAGCTTCCTCGGGTCAGATCCAGCCTGGGCTAGCAACCTCTTTGTGCCTTTGCCA
  GTGAGGAGAGGGGGTCTGGTTCTGATCCATGGAGAAGTGGTGCATAAGAGTGAGCAGAACCATTCCGACC
  ACTCCCGCCAGGCCTACACTGTCCACCTCATGGAGGCTGCCGGCACTGTCTGGAGCCCAGGGAATTGGCT
  CCAGCCCACGCCCGAGCTGCCCTTCCCACCACTCTACAGCTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252571
• Insert Size: 813 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252571.1, NP_001239500.1
• RefSeq Size: 1237 bp
• RefSeq ORF: 813 bp
• Locus ID: 227696
• Cytogenetics: 2 B
• Gene Summary: Has alpha-ketoglutarate-dependent dioxygenase activity. Does not show detectable activity towards fatty acid CoA thioesters. Is not expected to be active with phytanoyl CoA (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and an internal coding exon, and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.