Pafah2 (NM_001285877) Mouse Untagged Clone

CAT#: MC226707

Pafah2 (untagged) - Mouse platelet-activating factor acetylhydrolase 2 (Pafah2), transcript variant 5

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pafah2
• Synonyms: 2310074E22Rik; AI507170
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226707 representing NM_001285877
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGCTGGCCTCTCGTGGCTTTGTGGTTGCTGCCGTAGAGCACAGGGACCAGTCAGCTGCGGCCACCT
  ACTTCTGCAAGCCGACCTCCCAGGAGAGCTCTCCCGCTGAATCTCTGGAGGAGGAGTGGCTCCCCTTCCG
  TCGCATCAAGGAAGGGGAGAAGGAGTTCCACGTCAGGAATCCTCAGGTGCACCAGCGGGTGAAAGAGTGT
  GTGCGAGTGCTGCGGATCCTTCAGGACGCCTCTGCTGGGAAGACTGTCGTCAATGTCTTCCCAGGAGGAC
  TGGATCTGATGACCTTGAAGGGCAGCATCGACAGGAACCGCGTAGCCGTGATGGGTCACTCCTTTGGAGG
  AGCTACGGCTGTTCTTGCTTTGACCCAGGAGGTCCAGTTTCGGTGTGCTATAGCCCTGGACGCTTGGATG
  TTCCCTCTGGAACGGGACTTTTACCCCAAAGCCCGGGGCCCTGTGTTCTTTATCAACGTCGAGAAATTCC
  AGACGGTAGAGAGCGTCAACTTGATGAAGAAGATCTGTGCCCAGCACGAGCAGTCCAGGATCGTGACTGT
  CCTAGGCGCTGTTCATCGGAGTCAAACTGACTTTGCCTTTGTGACGGGCAACCTGATTGCTAAATTCTTT
  TCCAGTAACTCTCGTGGTACCTTGGACCCTTACGAAAGTCAGGAGGTCATGGTGAGGGCCATCTTGGCCT
  TCCTGCAGAAGCACCTTGACCTGAAGGAAGACTACGATCAATGGAGCAGCTTCATCGAAGGCGTCGGACC
  ATCGCTCATCCAAGGGGCCCCGCACTATCTGTCTAGTCTATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001285877
• Insert Size: 813 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001285877.1, NP_001272806.1
• RefSeq Size: 2830 bp
• RefSeq ORF: 813 bp
• Locus ID: 100163
• Cytogenetics: 4 D3
• Gene Summary: Has a marked selectivity for phospholipids with short acyl chains at the sn-2 position. May share a common physiologic function with the plasma-type enzyme (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) lacks three exons in the 5' region and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 4 and 5 encode isoform c.