Dram2 (NM_001286987) Mouse Untagged Clone

SKU
MC226690
Dram2 (untagged) - Mouse DNA-damage regulated autophagy modulator 2 (Dram2), transcript variant 4
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dram2
Synonyms 2010305N14Rik; 2610318G18Rik; AI647667; Tmem77
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226690 representing NM_001286987
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGTGGTTTCAGCAAGGCCTCAGTTTTCTTCCGTCGGCCCTTGTAATTTGGACATTTGCTACCTTCA
TATTCTCATATATCACTGCAATAACACTCCACCATGTTGACCCTGCATTGCCTTATATCAGCGACACAGG
GACAATACCTCCTGAAAGATGCCTCTTTGGAGTAATGCTAAATATCGCTGCAGTTTTAGGCATTGCTACC
ATGTATGTTCGTTACAAGCAAGTTCATGCACTGAACCCTGAAGAGAACCTTATCATCAAATTAAACAAGG
CTGGCCTTGTACTTGGGATACTGAGTTGTTTAGGACTTTCCCTTGTGGCAAATTTCCAGAAATCAACACT
ATTTATTGTACATGTGTGTGGAGCTGTCCTTGCCTTTAGTATGGGCTCATTTTACATGTTTGTTCAGACA
ATCCTTTCCTACCAAATGCAGCCCAAAATTCACAGCAAACAAGTCTTCTGGGTCCGACTACTGTTGGTTA
TCTGGTGTGGAGTAAGTGCACTTAGCATGATGACTTGCTCATCAATTTTGTACAGTAGTGATTTTGGTCC
TGATGTAGTACAGAAACTACACTGGAACCCGGAGGACAAAGGCTATGTGCTTCACCTGGTTACTACGGCA
GCAGAATGGTCCATGTCATTTTCCTTTTTTGGATTTTTCCTTACTTATATTCGTGATTTTCAGAAAATTA
CTTTGCGGGTGGAAGCCAATTTACATGGATTAACCCTCTATGACACTGTTCCTTGCCCTGTTAACAATGA
AAGAACACCACTGCTTTCCAGAGATTTTCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001286987
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001286987.1, NP_001273916.1
RefSeq Size 2597 bp
RefSeq ORF 804 bp
Locus ID 67171
UniProt ID Q9CR48
Cytogenetics 3 F2.3
Summary Plays a role in the initiation of autophagy. In the retina, might be involved in the process of photoreceptor cells renewal and recycling to preserve visual function. Induces apoptotic cell death when coexpressed with DRAM1.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 2. Variants 2, 3 and 4 encode the same protein (isoform 2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001286987" in other vectors (1)
SKU Description Size Price
MR228901 Dram2 (myc-DDK-tagged) - Mouse DNA-damage regulated autophagy modulator 2 (Dram2), transcript variant 4 10 ug
$289.00 $300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.