Tmem53 (NM_001285814) Mouse Untagged Clone

CAT#: MC226646

Tmem53 (untagged) - Mouse transmembrane protein 53 (Tmem53), transcript variant 4

USD 258.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem53 (NM_001285814) Mouse Untagged Clone
Symbol Tmem53
Synonyms 1110038M16Rik; 1500001P22Rik; 1700012A05Rik
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC226646 representing NM_001285814
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATCCTGATGGAAAGAACAGACAAGGTGGGAAGGAAGCTGGGAAGCAACAGCCTGTGGTGATTCTCT
TGGGCTGGGGAGGCTGCAGGGACAAGAACCTGGCCAAGTATAGTGCTATCTACCACAAAAGGGGCTGCAT
TGTGATCCGATACACGGCCCCCTGGCACATGGTCTTCTTCTCTGAGTCCTTGGGCATCCCTTCACTTCGC
GTGATAGCCCAGAAACTGCTGGAGCTCCTCTTTGACTATGAGATTGAGCGGGAGCCTCTGCTCTTCCACG
TCTTCAGCAATGCCGGCGTCATGCTCTACCGCTACGTGCTGGAGCTCCTACAGACCCACCAGCGCTTCCG
CCATTTGCATGTGGTGGGCACCATCTTTGACAGTGGTCCTGGCGATAGCAACCTGATAGGGGCCCTGAGG
GCTCTGGCAACCATCCTGGAGCGCCGACCTGCGGTGCTGCGCCTGTTGCTCCTGGCAGCATTTGCCCTGG
TGGTGATCCTGTTTCACTTCCTGCTTGCTCCATTCACTGCCCTCTTCCACACCCACTTCTACGACAGGCT
GCAGGACTCAGGCTCCTGCTGGCCTGAACTCTACCTCTACTCTAGAGCTGATAAGGTGGTCTCGGCCAGG
GATGTGGAACGTATGGTAGAGGCACGCCTGGCTCACCAGGTCATGGTGCGTGGAGTGGACTTTGTGTCAT
CTGCGCATGTCAGCCACCTCCGAGACTATCCTACTTACTATACAAGTCTGTGTGTTGACTTCATGCATAA
TTGTGTCCAATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001285814
ORF Size 786 bp
Insert Size 786
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001285814.1, NP_001272743
RefSeq Size 1085
RefSeq ORF 786
Locus ID 68777
Cytogenetics 4|4 D1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.