Tnfrsf9 (NM_011612) Mouse Untagged Clone

CAT#: MC226612

Tnfrsf9 (untagged) - Mouse tumor necrosis factor receptor superfamily, member 9 (Tnfrsf9), transcript variant 1

USD 248.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tnfrsf9 (NM_011612) Mouse Untagged Clone
Symbol Tnfrsf9
Synonyms 4-1BB; A930040I11Rik; AA408498; AI325004; Cd137; CDw137; ILA; Ly63
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC226612 representing NM_011612
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAAACAACTGTTACAACGTGGTGGTCATTGTGCTGCTGCTAGTGGGCTGTGAGAAGGTGGGAGCCG
TGCAGAACTCCTGTGATAACTGTCAGCCTGGTACTTTCTGCAGAAAATACAATCCAGTCTGCAAGAGCTG
CCCTCCAAGTACCTTCTCCAGCATAGGTGGACAGCCGAACTGTAACATCTGCAGAGTGTGTGCAGGCTAT
TTCAGGTTCAAGAAGTTTTGCTCCTCTACCCACAACGCGGAGTGTGAGTGCATTGAAGGATTCCATTGCT
TGGGGCCACAGTGCACCAGATGTGAAAAGGACTGCAGGCCTGGCCAGGAGCTAACGAAGCAGGGTTGCAA
AACCTGTAGCTTGGGAACATTTAATGACCAGAACGGTACTGGCGTCTGTCGACCCTGGACGAACTGCTCT
CTAGACGGAAGGTCTGTGCTTAAGACCGGGACCACGGAGAAGGACGTGGTGTGTGGACCCCCTGTGGTGA
GCTTCTCTCCCAGTACCACCATTTCTGTGACTCCAGAGGGAGGACCAGGAGGGCACTCCTTGCAGGTCCT
TACCTTGTTCCTGGCGCTGACATCGGCTTTGCTGCTGGCCCTGATCTTCATTACTCTCCTGTTCTCTGTG
CTCAAATGGATCAGGAAAAAATTCCCCCACATATTCAAGCAACCATTTAAGAAGACCACTGGAGCAGCTC
AAGAGGAAGATGCTTGTAGCTGCCGATGTCCACAGGAAGAAGAAGGAGGAGGAGGAGGCTATGAGCTGTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_011612
ORF Size 771 bp
Insert Size 771
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_011612.2, NP_035742
RefSeq Size 2134
RefSeq ORF 771
Locus ID 21942
Cytogenetics 4 E2|4 81.52 cM
Gene Summary Receptor for TNFSF9/4-1BBL. Possibly active during T cell activation. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.