Mbnl1 (NM_001253709) Mouse Untagged Clone

SKU
MC226597
Mbnl1 (untagged) - Mouse muscleblind-like 1 (Drosophila) (Mbnl1), transcript variant 3
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mbnl1
Synonyms Mbnl; mKIAA0428
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226597 representing NM_001253709
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCATGCTGGCCCAGCAAATGCAGTTAGCCAATGCCATGATGCCCGGTGCCCCGTTGCAGCCCGTGC
CAATGTTTTCAGTTGCACCAAGCTTAGCCACCAGTGCATCAGCAGCCTTTAACCCTTACCTGGGGCCTGT
TTCCCCAAGCCTGGTTCCAGCAGAGATCTTGCCGACTGCACCAATGTTGGTCACGGGGAATCCTGGAGTT
CCAGTGCCAGCAGCTGCCGCAGCTGCTGCACAGAAGTTAATGCGGACAGACAGACTGGAGGTGTGTCGAG
AGTACCAGCGTGGCAATTGCAACAGAGGAGAAAATGACTGTCGGTTTGCTCATCCTGCTGACAGCACAAT
GATTGATACCAATGACAACACAGTCACTGTCTGCATGGATTACATCAAGGGGAGATGCTCTCGGGAAAAG
TGCAAATACTTCCATCCTCCCGCACACCTGCAAGCCAAGATCAAGGCTGCCCAATACCAGGTCAACCAGG
CTGCAGCAGCACAGGCTGCAGCTACTGCAGCTGCCATGGCTCTAGCCAACATGCAGTTACAGCAGCATAC
AGCATTTCTCCCACCAGGCTCAATATTGTGCATGACACCCGCTACAAGTGTTGTTCCCATGGTGCACGGT
GCTACGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAG
CCAACCAGATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001253709
Insert Size 765 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001253709.2, NP_001240638.1
RefSeq Size 4519 bp
RefSeq ORF 765 bp
Locus ID 56758
Cytogenetics 3 D
Summary Mediates pre-mRNA alternative splicing regulation. Acts either as activator or repressor of splicing on specific pre-mRNA targets. Inhibits cardiac troponin-T (TNNT2) pre-mRNA exon inclusion but induces insulin receptor (IR) pre-mRNA exon inclusion in muscle. Antagonizes the alternative splicing activity pattern of CELF proteins. Regulates the TNNT2 exon 5 skipping through competition with U2AF2. Inhibits the formation of the spliceosome A complex on intron 4 of TNNT2 pre-mRNA. Binds to the stem-loop structure within the polypyrimidine tract of TNNT2 intron 4 during spliceosome assembly. Binds to the 5'-YGCU(U/G)Y-3'consensus sequence. Binds to the IR RNA. Binds to CUG triplet repeat expansion in myotonic dystrophy muscle cells by sequestering the target RNAs (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) lacks the exon containing the start codon and uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001253709" in other vectors (1)
SKU Description Size Price
MR228808 Mbnl1 (myc-DDK-tagged) - Mouse muscleblind-like 1 (Drosophila) (Mbnl1), transcript variant 3 10 ug
$330.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.