Mdfi (NM_001276391) Mouse Untagged Clone

CAT#: MC226583

Mdfi (untagged) - Mouse MyoD family inhibitor (Mdfi), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mdfi
• Synonyms: I-mf; I-mfa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226583 representing NM_001276391
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCACCCCTAGTCCTTGATGTGGTCCCTTTTCTCCTTTCCCTTATCTGGGGTATTCTGAGTACCAACA
  CTCAGTCACAGACGTGCAGAGCCCAGACCATGTCCCTCCTCCCTGGGCTGGAGGTAGCAAGATCCACTCA
  CCCTGTAGAGGCATCTTCTGAAGAGGGCTTCCCGGAGGAGGCGGCACCCTCCATGCCCCATGACAGTGGT
  CTCCGGGCTCAGCAGGCTCTGAACAGCATTGACCTCGATGTCCCCACAGAAGCTGTGACGTGCCAGCCTC
  AAGGGAACCCCCAAGGCTGCACCCCACTACTGCCAAATGGCTCCAGCCACGACCACCTCTCAGAACCGGG
  CAGTGCAGGGCATGCGGGGAACGGTGCTCTGGGCGGGTCCAAGGCCCACCGGAAGTTGCAGACGCATCCA
  TCTCTGGGCAGCCAGGCTGGAAGGAAAAGCAGAGGCAGCGCCCGGTCAGCCTCACAGGTCCCTCTCCAGG
  CACAGGAAGATTGCTGCGTCCACTGCATACTGTCCTGTCTATTCTGTGAGTTCCTGACGCTCTGTAACAT
  CCTCCTGGACTGCGCCACCTGTGGCTCCTGCAGCTCTGAGGACTCCTGCCTCTGCTGCTGCTGCTGTGGG
  TCCGGCGAGTGCGCGGACTGTGACCTGCCCTGCGACCTGGACTGCGGCATCGTGGATGCCTGCTGCGAGT
  CCGCAGACTGCTTGGAGATATGCATGGAGTGCTGTGGACTCTGTTTCTCCTCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276391
• Insert Size: 756 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276391.1, NP_001263320.1
• RefSeq Size: 1483 bp
• RefSeq ORF: 756 bp
• Locus ID: 17240
• Cytogenetics: 17 23.99 cM
• Gene Summary: Inhibits the transactivation activity of the Myod family of myogenic factors and represses myogenesis. Acts by associating with Myod family members and retaining them in the cytoplasm by masking their nuclear localization signals. Can also interfere with the DNA-binding activity of Myod family members. Plays an important role in trophoblast and chondrogenic differentiation. Regulates the transcriptional activity of TCF7L1/TCF3 by interacting directly with TCF7L1/TCF3 and preventing it from binding DNA. Binds to the axin complex, resulting in an increase in the level of free beta-catenin. Affects axin regulation of the WNT and JNK signaling pathways.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) uses an alternate 5' exon structure, differs in the 5' UTR, contains an alternate exon in the 5' coding region and uses a downstream start codon compared to variant 2. It encodes isoform 2 which is longer and has a distinct N-terminus, compared to isoform 1.