Dao (NM_001286397) Mouse Untagged Clone

CAT#: MC226563

Dao (untagged) - Mouse D-amino acid oxidase (Dao), transcript variant 3

USD 248.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dao (NM_001286397) Mouse Untagged Clone
Symbol Dao
Synonyms AI987963; DAAO; DAMOX; Dao-1; Dao1
Vector pCMV6-Entry
Sequence Data
>MC226563 representing NM_001286397
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGCGTGGCCGTGATCGGAGCAGGAGTCATTGGGCTCTCCACAGCCCTCTGCATTCATGAGCGTTACC
ACCCAACACAGCCACTGCACATGAAGATCTATGCAGATCGATTCACCCCGTTCACCACGAGCGATGTGGC
CGCCGGCCTCTGGCAGCCTTATCTCTCTGACCCCAGCAACCCTCAGGAGGCGGAGTGGAGCCAGCAAACG
TTTGATTACCTGCTGAGCTGCCTCCATTCTCCAAACGCTGAAAAAATGGGCCTGGCCCTAATCTCAGGCT
ACAACCTCTTCCGAGATGAAGTTCCGGACCCTTTCTGGAAAAACGCAGTTCTGGGATTCCGGAAGCTGAC
CCCCAGTGAGATGGACCTGTTCCCTGATTATGGCTACGGCTGGTTCAATACAAGCCTCCTTCTAGAGGGG
AAGAGCTACCTGCCATGGCTAACTGAGAGGTTAACTGAGAGGGGAGTGAAGCTTATCCATCGGAAGGTGG
AGTCTCTCGAAGAGGTGGCAAGAGGAGTGGATGTGATTATCAACTGCACCGGGGTGTGGGCCGGGGCCCT
GCAAGCAGATGCCTCCCTGCAGCCAGGCCGGGGCCAGATCATCCAGGTGGAGGCCCCTTGGATTAAACAC
TTCATCCTCACCCATGATCCTAGCCTTGGTATCTACAACTCTCCGTACATCATCCCAGGAATGCAAGAAT
TGTGGGTGAACTCACTGGCTTCCGGCCAGTCCGGCCTCAGGTCCGGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001286397
ORF Size 750 bp
Insert Size 750
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001286397.1, NP_001273326
RefSeq Size 1751
RefSeq ORF 750
Locus ID 13142
Cytogenetics 5 F|5 55.93 cM
Gene Summary Regulates the level of the neuromodulator D-serine in the brain. Has high activity towards D-DOPA and contributes to dopamine synthesis. Could act as a detoxifying agent which removes D-amino acids accumulated during aging. Acts on a variety of D-amino acids with a preference for those having small hydrophobic side chains followed by those bearing polar, aromatic, and basic groups. Does not act on acidic amino acids. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.