Milr1 (NM_001271373) Mouse Untagged Clone

CAT#: MC226545

Milr1 (untagged) - Mouse mast cell immunoglobulin like receptor 1 (Milr1), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Milr1
• Synonyms: Allergin-1; Gm885; Mca32
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226545 representing NM_001271373
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCGATGGTGACTCGCCAATGTGCCTCTCTGCCGTTTCATTCAAGGGAATAAGATGCTGGCTGGACA
  AACTGTTACTTTGGGCTCTTACAATTTCTATCACACTTCAGAATGCTGCAGTGGATTGTACGAGGGTGGA
  AAATAACGAATTACCTTCTCCAAATCTGAACTCAAGTATGAACGTGGTCAGGATGGGCCAAAATGTATCT
  CTGTCTTGTTCCACCAAGAACACATCAGTAGACATCACCTATTCGCTCTTCTGGGGTACAAAATATCTAG
  AAAGCAAGAGAAGACGAGGGGGAGCTGTGGATTTCCACCTGAGGATCTCCAATGCCAACGAGTCAGGCCC
  CTACAAATGCAAAGTCAATGTTTCCAACTTGATGAAATACAGTCAGGATTTCAACTTCACAATGGCCAGG
  GGAAGACACAAAACCCAAACAAATGGCTCACAAGCTGTGCCAGCTGTTGTAAAGGACACAAGCACAGTGT
  GGAGAAAGGCAAGGCATGAAGAAGGGACCACCTGGGAAAGAAGACTCAGAGAGAGGACCAGTCCAAGGGT
  TCTGGAGATGCGCCTGCACAGGACGAGCTGTATGTCAACGCCTGCAAGACTCAGACAGAGCAACCCCAGG
  AGATACACTATGCCACTCCAGTCTTCAAGGAGATGGCACCCATGGAAGAAGAAGGTGGTACGGATGGAAA
  AGCTGATTACATCTACTCTGAACTCACCCACTGAAGTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271373
• Insert Size: 741 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271373.1, NP_001258302.1
• RefSeq Size: 1552 bp
• RefSeq ORF: 741 bp
• Locus ID: 380732
• UniProt ID: Q3TB92
• Cytogenetics: 11 E1
• Gene Summary: Immunoglobulin-like receptor which plays an inhibitory role in degranulation of mast cells. Negatively regulates IgE-mediated mast cell activation and suppresses the type I immediate hypersensitivity reaction.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an alternate exon and lacks an exon, compared to variant 1. These changes result in a frameshift. The encoded isoform (c) has a distinct C-terminus, compared to isoform a.