Dcun1d1 (NM_001205362) Mouse Untagged Clone
CAT#: MC226531
Dcun1d1 (untagged) - Mouse DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (Dcun1d1), transcript variant 2
"NM_001205362" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Dcun1d1 |
Synonyms | pTes3; Rp42; SCCRO; Tes3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226531 representing NM_001205362
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCTTCACACAATCTAGTGAGAAAACTGCAGTAAGTTGTCTTTCTCAAAATGACTGGAAGTTAGATG TTGCAACAGATAATTTTTTTCAAAATCCAGAACTTTATATACGGGAGAGTGTAAAAGGATCGTTGGACAG GAAGAAGTTAGAGCAACTGTACACTAGATACAAAGACCCTCAGGATGAAAATAAAATTGGAATAGATGGT ATACAGCAGTTCTGTGATGATCTGGCCCTCGATCCAGCCAGCATCAGTGTGTTGATCATTGCATGGAAGT TCAGGGCGGCCACACAGTGCGAGTTCTCCAAACAGGAGTTCATGGATGGCATGACAGAGTTAGGATGTGA CAGCATAGAAAAACTAAAGGCCCAAATACCCAAGATGGAACAAGAATTGAAAGAACCAGGACGATTTAAG GATTTTTACCAGTTTACTTTTAATTTTGCAAAGAATCCAGGACAAAAAGGATTAGATCTAGAAATGGCCA TTGCTTACTGGAACTTAGTGCTTAATGGAAGATTTAAATTCTTAGACTTATGGAATAAATTTTTGTTGGA GCATCATAAACGATCAATACCAAAAGACACGTGGAATCTTCTGTTAGACTTCAGTTCAATGATTGCAGAT GACATGTCCAATTATGATGAAGAAGGAGCATGGCCTGTCCTTATTGATGACTTTGTGGAATTTGCACGCC CTCAAATTGCTGGGACAAAAAGTACAACAGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001205362 |
Insert Size | 735 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001205362.1, NP_001192291.1 |
RefSeq Size | 4434 bp |
RefSeq ORF | 735 bp |
Locus ID | 114893 |
Cytogenetics | 3 B |
Gene Summary | Part of an E3 ubiquitin ligase complex for neddylation. Promotes neddylation of cullin components of E3 cullin-RING ubiquitin ligase complexes. Acts by binding to cullin-RBX1 complexes in the cytoplasm and promoting their nuclear translocation, enhancing recruitment of E2-NEDD8 (UBE2M-NEDD8) thioester to the complex, and optimizing the orientation of proteins in the complex to allow efficient transfer of NEDD8 from the E2 to the cullin substrates. Involved in the release of inhibitory effets of CAND1 on cullin-RING ligase E3 complex assembly and activity (By similarity). Acts also as an oncogene facilitating malignant transformation and carcinogenic in vivo (PubMed:20563250).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228742 | Dcun1d1 (myc-DDK-tagged) - Mouse DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) (Dcun1d1), transcript variant 2 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review