Slbp (NM_001289725) Mouse Untagged Clone

CAT#: MC226511

Slbp (untagged) - Mouse stem-loop binding protein (Slbp), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Slbp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226511 representing NM_001289725
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTGCAGACCTAGAAGCCCACCCGGTTATGGGAGTCGCCGCGACGGTGGTGCGAGCCCGCGGTCCC
  CTGCGAGATGGAGTCTCGGACGGAAGCGCAGAGCGGACGGAAGGGACCGGAAGCCCGAGGACTCCGAGGA
  AGGCGAGCTCCAGACTGCGGACCACCGACCTGAAAGGTACAAAAGAAAACTGCTCATAAACGACTTTGGG
  AGAGAGAGGAAGTCATCATCGGGAAGTTCTGATTCAAAGGAGTCTATGTCTTCAGTGCCTGCTGATGTGG
  AGACGGATGAAAGTGTCTTGATGAGAAGGCAGAAGCAGATCAACTACGGGAAGAACACTATTGCCTATGA
  TCGATATATTAAAGAGGTGCCCAGACACCTGCGACAACCTGGAATCCATCCCAGGACCCCCAACAAATTT
  AAGAAGTACAGCCGGCGGTCATGGGACCAACAAATTAAACTCTGGAAGGTGGCTTTGCATTTTTGGGATC
  CTCCTGCTGAAGAAGGATGTGATTTGCAAGAAATACAACCTGTAGATCTTGGGGAAATGGAGACTGAATT
  CACAGAAAGCAGCTCTGAGTCTCAGACAAGTTCACAGGATAACTTTGATGTGTATGCTGGCACACCCACC
  AAAGTCAGACACGTGGACTGCCAAGTGGAGGATGAGTTTGATTTGGAAGCTTGTTTAACTGAACCTTTGA
  AAGACTTCTCTGCCATGAGTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289725
• Insert Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289725.1, NP_001276654.1
• RefSeq Size: 1816 bp
• RefSeq ORF: 723 bp
• Locus ID: 20492
• Cytogenetics: 5 B2
• Gene Summary: RNA-binding protein involved in the histone pre-mRNA processing. Binds the stem-loop structure of replication-dependent histone pre-mRNAs and contributes to efficient 3'-end processing by stabilizing the complex between histone pre-mRNA and U7 small nuclear ribonucleoprotein (snRNP), via the histone downstream element (HDE). Plays an important role in targeting mature histone mRNA from the nucleus to the cytoplasm and to the translation machinery. Stabilizes mature histone mRNA and could be involved in cell-cycle regulation of histone gene expression (By similarity). Involved in the mechanism by which growing oocytes accumulate histone proteins that support early embryogenesis. Binds to the 5' side of the stem-loop structure of histone pre-mRNAs.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.