Cidec (NM_001301295) Mouse Untagged Clone

CAT#: MC226502

Cidec (untagged) - Mouse cell death-inducing DFFA-like effector c (Cidec), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cidec
• Synonyms: CIDE-3; Fsp27
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226502 representing NM_001301295
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACTACGCCATGAAGTCTCTCAGCCTCCTGTACCCCAGGTCGCTGTCCAGGCATGTGGCAGTGAGCA
  CGGCAGTGGTGACCCAACAGCTGGTGTCTAAGCCCAGCCGGGAGACCCCGAGGGCCAGGCCCTGTCGTGT
  TAGCACCGCAGATCGGAAGGTTCGCAAAGGCATCATGGCTCACAGCTTGGAGGACCTCCTGAACAAGGTC
  CAGGACATCTTGAAACTTAAAGACAAGCCCTTCTCCCTGGTGCTGGAGGAAGATGGCACAATCGTGGAGA
  CAGAAGAATACTTCCAAGCCCTGGCAAAAGATACCATGTTCATGGTCCTGCTGAAGGGGCAGAAGTGGAA
  GCCCCCATCAGAACAGCGCAAGAAGAGAGCCCAGCTAGCCCTTTCCCAGAAGCCAACTAAGAAGATCGAT
  GTGGCCCGGGTAACCTTCGACCTGTACAAGCTGAACCCTCAGGACTTTATTGGCTGCCTGAACGTGAAGG
  CAACCCTCTATGACACATACTCGCTTTCCTATGACCTGCACTGCTACAAGGCCAAGCGCATCGTGAAGGA
  GATGCTCCGCTGGACCCTCTTCAGCATGCAGGCCACCGGTCACATGCTGCTTGGCACCTCCAGCTACATG
  CAGCAGTTCCTGGATGCCACCGAGGAAGAACAGCCTGCCAAGGCCAAGCCCTCCTCCCTCCTCCCAGCCT
  GTCTGAAGATGCTGCAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301295
• Insert Size: 720 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301295.1, NP_001288224.1
• RefSeq Size: 1720 bp
• RefSeq ORF: 720 bp
• Locus ID: 14311
• UniProt ID: P56198
• Cytogenetics: 6 E3
• Gene Summary: Binds to lipid droplets and regulates their enlargement, thereby restricting lipolysis and favoring storage. At focal contact sites between lipid droplets, promotes directional net neutral lipid transfer from the smaller to larger lipid droplets. The transfer direction may be driven by the internal pressure difference between the contacting lipid droplet pair. Its role in neutral lipid transfer and lipid droplet enlargement is activated by the interaction with PLIN1. May act as a CEBPB coactivator in the white adipose tissue to control the expression of a subset of CEBPB downstream target genes, including SOCS1, SOCS3, TGFB1, TGFBR1, ID2 and XDH. When overexpressed in preadipocytes, induces apoptosis or increases cell susceptibility to apoptosis induced by serum deprivation or TGFB treatment. As mature adipocytes, that express high CIDEC levels, are quite resistant to apoptotic stimuli, the physiological significance of its role in apoptosis is unclear. May play a role in the modulation of the response to osmotic stress by preventing NFAT5 to translocate into the nucleus and activate its target genes expression.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from genomic sequence data because no single transcript from the reference strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.