D17Wsu92e (NM_001271511) Mouse Untagged Clone

CAT#: MC226499

D17Wsu92e (untagged) - Mouse DNA segment, Chr 17, Wayne State University 92, expressed (D17Wsu92e), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: D17Wsu92e
• Synonyms: AU020189; C030010A15; C80239
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226499 representing NM_001271511
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGGCATGGACGTGGACTTGGATCCGGAGCTCATGCAGAAGTTCAGCTGCCTGGGCACCACAGACA
  AGGACGTGCTCATCTCCGAGTTCCAGCGGCTACTCGGCTTCCAGCTCAACCCGGCCGGCTGCGCCTTCTT
  CCTGGACATGACCAACTGGAACTTACAAGCAGCGATTGGCGCCTATTATGACTTCGAGAGCCCAAATATC
  AGTGTGCCCTCCATGTCCTTTGTTGAAGATGTCACCATAGGAGAAGGGGAGTCAATACCCCCTGATACCC
  AGTTCATAAAAACTTGGCGGATACAGAATTCTGGAGCAGAGGCCTGGCCTCCAGGGGTTTGTCTTAAATA
  TGTCGGGGGAGACCAGTTTGGACATGTGAACATGGTGATGGTGAGATCACTAGAGCCCCAAGAGATCGCA
  GACGTCAGCGTCCAGATGTGCAGTCCCAGCAGAGCAGGCATGTACCAGGGACAGTGGCGGATGTGCACTG
  CTACTGGACTCTACTATGGAGGGGCTCCACGGGCCTTACCCCTTCGGCCAGTCTTAAACGGGTGTCAGCA
  AGAAGAAAAACTAACAAAAGACAGAAGGCCTGACTTTGGGGGGAGAGGGCAAGGGGTTCCTCTGGATTGC
  AGACCACATCGCACGGACCCCTGGCTCAGACCCCCACCTACCCCCCAATCACAGAAGAAGAGGAAGAAAG
  AGACTAGTTTTGAGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271511
• Insert Size: 717 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271511.1, NP_001258440.1
• RefSeq Size: 3483 bp
• RefSeq ORF: 717 bp
• Locus ID: 224647
• UniProt ID: Q3TT38
• Cytogenetics: 17 14.59 cM
• Gene Summary: Negative regulator of innate antiviral response. Blocks IRF3-dependent cytokine production such as IFNA, IFNB and TNF. Interacts with IRF3 and inhibits IRF3 recruitment to type I IFN promoter sequences while also reducing nuclear levels of the coactivators EP300 and CREBBP.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) lacks an alternate exon, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.