Nrl (NM_001271916) Mouse Untagged Clone

CAT#: MC226481

Nrl (untagged) - Mouse neural retina leucine zipper gene (Nrl), transcript variant 3


  "NM_001271916" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NRL Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nrl
Synonyms D14H14S46E
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226481 representing NM_001271916
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTTCCCTCCCAGTCCCTTGGCTATGGAATATGTTAATGACTTTGATTTGATGAAGTTCGAAATAA
AGCGGGAGCCTTCTGAGGGCCGATCTGGAGTCCCCACAGCCTCGTTGGGCTCCACACCATACAGCTCGGT
GCCTCCTTCACCCACCTTCAGTGAGCCAGGCATGGTGGGTGGTGGCGAGGCCCCTAGGCCAGGCCTGGAG
GAGCTATATTGGCTGGCCACCCTGCAGCAGCAGCTGGGGTCGGATGAGGTTCTCGGGCTGAGTCCCGACG
AAGCTGTGGAGCTGCTGCAGAACCAGGGTCCTGTCTCTATGGAAGGGCCTCTTGGCTACTATTCAGGGAG
CCCGGGAGAGACAGGAGCCCAGCATGTCCAGCTGCCCGAGAGATTTTCGGACGCCGCGCTGGTCTCGATG
TCTGTGCGCGAGTTGAACCGGCAGCTGCGGGGCTGCGGGCGCGACGAGGCTCTGCGGCTGAAGCAGAGGC
GCCGCACGCTCAAGAACCGCGGCTACGCTCAGGCTTGTCGCTCCAAGCGGCTGCAACAGCGGCGCGGGCT
GGAGGCAGAGCGCGCTCGCCTGGCCGCCCAGCTGGATGCCCTGCGGGCCGAGGTGGCACGCCTGGCTCGC
GAGCGCGACCTCTATAAGGCCCGCTGTGACCGGCTGACCTCCGGCGGCCCTGGGTCCGACGACCACACAC
ACCTCTTCCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271916
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271916.1, NP_001258845.1
RefSeq Size 2504 bp
RefSeq ORF 714 bp
Locus ID 18185
UniProt ID P54846
Cytogenetics 14 28.19 cM
Gene Summary This gene encodes a member of the basic leucine zipper domain family of transcription factors. The encoded protein is preferentially expressed in the retina and is necessary for rod photoreceptor development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (3) represents the longest transcript. Variants 1, 2, 3, and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.