Pomc (NM_001278582) Mouse Untagged Clone

SKU
MC226467
Pomc (untagged) - Mouse pro-opiomelanocortin-alpha (Pomc), transcript variant 2
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pomc
Synonyms ACT; ACTH; alp; alph; alpha-MSH; alphaMSH; BE; Beta-LPH; beta-M; beta-MSH; Clip; gamma-; Gamma-LPH; gamma-MSH; Npp; PO; Pomc-1; Pomc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226467 representing NM_001278582
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAGATTCTGCTACAGTCGCTCAGGGGCCCTGTTGCTGGCCCTCCTGCTTCAGACCTCCATAGATG
TGTGGAGCTGGTGCCTGGAGAGCAGCCAGTGCCAGGACCTCACCACGGAGAGCAACCTGCTGGCTTGCAT
CCGGGCTTGCAAACTCGACCTCTCGCTGGAGACGCCCGTGTTTCCTGGCAACGGAGATGAACAGCCCCTG
ACTGAAAACCCCCGGAAGTACGTCATGGGTCACTTCCGCTGGGACCGCTTCGGCCCCAGGAACAGCAGCA
GTGCTGGCAGCGCGGCGCAGAGGCGTGCGGAGGAAGAGGCGGTGTGGGGAGATGGCAGTCCAGAGCCGAG
TCCACGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAACGG
CGCCCGGTGAAGGTGTACCCCAACGTTGCTGAGAACGAGTCGGCGGAGGCCTTTCCCCTAGAGTTCAAGA
GGGAGCTGGAAGGCGAGCGGCCATTAGGCTTGGAGCAGGTCCTGGAGTCCGACGCGGAGAAGGACGACGG
GCCCTACCGGGTGGAGCACTTCCGCTGGAGCAACCCGCCCAAGGACAAGCGTTACGGTGGCTTCATGACC
TCCGAGAAGAGCCAGACGCCCCTGGTGACGCTCTTCAAGAACGCCATCATCAAGAACGCGCACAAGAAGG
GCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001278582
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001278582.1, NP_001265511.1
RefSeq Size 1149 bp
RefSeq ORF 708 bp
Locus ID 18976
UniProt ID P01193
Cytogenetics 12 1.99 cM
Summary This gene encodes a polypeptide hormone precursor that undergoes extensive, tissue-specific, post-translational processing. Processing yields several biologically active peptides, which are involved in diverse cellular functions, such as energy homeostasis, steroidogenesis, and increased melanin production in melanocytes. In mouse deficiency of this gene is associated with obesity, defects in adrenal development, and altered pigmentation. A pseudogene of this gene is located on chromosome 19. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jun 2013
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001278582" in other vectors (1)
SKU Description Size Price
MR228678 Pomc (myc-DDK-tagged) - Mouse pro-opiomelanocortin-alpha (Pomc), transcript variant 2 10 ug
$289.00 $300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.