OriGene Logo

Stard6 (NM_001289649) Mouse Untagged Clone

Be the first to review this product
SKU
MC226452
Stard6 (untagged) - Mouse StAR-related lipid transfer (START) domain containing 6 (Stard6), transcript variant 3
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
AAV Particle:
DDK
  $330.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Stard6 or NM_001289649"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Stard6
Synonyms 1700011K09Rik; 4833424I06Rik; 4933429L05Rik; AI644424
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226452 representing NM_001289649
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTATAAGGCAATTGCCCAACAAACTGCTGAACAAGTTTTAGCTTACAATCAAGACCTATCTGGCT
GGAAACTCATTAAATCTTCAAAAAAGGTAACTGTTTCCAGCAAGACCTCTAGAATATTCCACGGAAACCT
ATACCGCGTTGAAGGAATAATCCCAGAATCAGCAGCTCATCTCTCTGACTTCCTCTTCAAACATGATCAC
AGAGTCTCATGGGACAAATCATTGAAAGGGTTCAATGTGATACACAAGATTGATTCGGACACACTCATAT
GCCACACCATTACACAAAGTTTTGCCATGGGCTCAATTTCCCCTAGAGACTTTATCGACTTAGTACACAT
CAAGCACTATGAAAGGAACGTGGACATTATCAGTACTAAAAGTGTGGACTTCCCAGGATATGCTCCAACT
TCGACTTATATCCGTGGCTTTAATCATCCCTCTGGCTATGTGTGTTCACCTCTGAAGGAAAACCCAGCCT
ATTCCAAGCTAGTGATTTTTGTCCAGACAGAGATGAAAGGAAAATTGCCTGCATCGGTAATTGAAAAGTC
TATGCCTTCCAACTTAGTAAGCTTCCTCCTCAATGTGAAAGATGGCGTAAAGACGTACAGAATTCCACCC
ATACGTGCCCGGCACAGTTCGCACTCCTCTGTGCACAAAAAGAAAGAAGGACATTCTGCCATTAAACCGT
AG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001289649
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001289649.1, NP_001276578.1
RefSeq Size 1406 bp
RefSeq ORF 702 bp
Locus ID 170461
UniProt ID P59096
Cytogenetics 18 44.44 cM
Summary May be involved in the intracellular transport of sterols or other lipids. May bind cholesterol or other sterols (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001289649" in other vectors (1)
SKU Description Size Price
MR228663 Stard6 (myc-DDK-tagged) - Mouse StAR-related lipid transfer (START) domain containing 6 (Stard6), transcript variant 3 10 ug
$289.00 $300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.