Rab27a (NM_001301230) Mouse Untagged Clone

SKU
MC226378
Rab27a (untagged) - Mouse RAB27A, member RAS oncogene family (Rab27a), transcript variant 1
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rab27a
Synonyms 2210402C08Rik; 2410003M20Rik; 4933437C11Rik; ash
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226378 representing NM_001301230
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGGATGGAGATTACGATTACCTCATCAAGTTCTTGGCCTTGGGAGACTCTGGGGTAGGGAAGACCA
GTGTACTCTACCAGTACACTGATGGCAAGTTCAACTCCAAATTCATCACCACAGTGGGCATTGATTTCAG
GGAAAAGAGAGTGGTGTACAGAGCCAATGGGCCAGATGGAGCTGTGGGCCGAGGCCAGAGAATCCACCTG
CAGTTATGGGACACGGCGGGGCAGGAGAGGTTTCGTAGCTTAACCACTGCATTCTTCAGGGACGCTATGG
GTTTCCTGCTTCTGTTCGACCTGACAAATGAGCAAAGTTTCCTCAATGTCCGAAACTGGATAAGCCAGCT
ACAGATGCACGCGTACTGTGAAAACCCAGATATAGTGCTGTGTGGAAATAAGAGTGACCTGGAAGACCAG
AGGGCAGTGAAAGAGGAGGAGGCCCGGGAACTTGCCGAGAAGTACGGAATCCCCTATTTTGAAACCAGTG
CTGCCAACGGGACAAACATAAGCCACGCGATTGAGATGCTCCTGGACCTGATCATGAAGCGGATGGAGCG
GTGTGTGGACAAGTCCTGGATTCCGGAGGGAGTGGTACGGTCCAACGGCCATACCTCTGCGGATCAGCTA
AGTGAGGAGAAGGAGAAGGGGTTGTGTGGCTGTTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII |
ACCN NM_001301230
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001301230.1, NP_001288159.1
RefSeq Size 3215 bp
RefSeq ORF 666 bp
Locus ID 11891
UniProt ID Q9ERI2
Cytogenetics 9 40.08 cM
Summary The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jul 2014
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001301230" in other vectors (1)
SKU Description Size Price
MR228589 Rab27a (myc-DDK-tagged) - Mouse RAB27A, member RAS oncogene family (Rab27a), transcript variant 1 10 ug
$289.00 $300.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.