Drap1 (NM_001291080) Mouse Untagged Clone

CAT#: MC226331

Drap1 (untagged) - Mouse Dr1 associated protein 1 (negative cofactor 2 alpha) (Drap1), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Drap1
• Synonyms: 2310074H19Rik; NC2-alpha
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226331 representing NM_001291080
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCAAGCAAGAAGAAGAAGTATAACGCGCGGTTTCCGCCGGCGCGGATCAAAAAGATCATGCAGACGG
  ACGAAGAGATTGGGAAGGTGGCGGCAGCTGTGCCTGTCATCATCTCCCGGGCCCTTGAGCTCTTCCTGGA
  GTCCCTGTTGAAGAAGGCTTGCCAGGTGACCCAGTCTCGAAATGCCAAAACCATGACCACGTCCCACCTG
  AAGCAGTGCATTGAACTCGAGCAGCAGTTTGACTTCTTGAAAGACTTGGTGGCATCAGTGCCTGACATGC
  AGGGGGATGGGGAGGACAACCACGTGGATGGGGACAAGGGTCCTCGAAGATGGACTGTACCTTCCCGAAG
  GGGCCGGAAACCGGGCAGCAGCGGCAGGAAGAACGGAGGCACGGGAAGCAAAGGCAAAGACAAGAAGCTG
  TCCGGGACAGACTCTGAGCAGGAGGATGAGTCTGAGGATACAGATACTGATGGGGAAGAAGAGACACCAC
  AGCTTCCACCCCAAGCCAGTCACCCTCCTGCCCACTTTCAGAGCCCTCCAACTCCCTTCATACCCTTCAC
  ATCTCCCCTGCCTTTGCCACCAGCACCCCCCGGCCCCTCAGCAGCCGATGCAGAGGATGAAGAGGATTAT
  GACTCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291080
• Insert Size: 639 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291080.1, NP_001278009.1
• RefSeq Size: 1020 bp
• RefSeq ORF: 639 bp
• Locus ID: 66556
• UniProt ID: Q9D6N5
• Cytogenetics: 19 A
• Gene Summary: The association of the DR1/DRAP1 heterodimer with TBP results in a functional repression of both activated and basal transcription of class II genes. This interaction precludes the formation of a transcription-competent complex by inhibiting the association of TFIIA and/or TFIIB with TBP. Can bind to DNA on its own (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.