Car7 (NM_001301164) Mouse Untagged Clone

CAT#: MC226310

Car7 (untagged) - Mouse carbonic anhydrase 7 (Car7), transcript variant 2

USD 206.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Car7 (NM_001301164) Mouse Untagged Clone
Symbol Car7
Synonyms AV343731; Ca7
Vector pCMV6-Entry
Sequence Data
>MC226310 representing NM_001301164
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCTCAGCATCACCAACAATGGCCACTCTGTCCAGGTGGACTTCAATGACAGTGATGACAGAACCG
TGGTGTCTGGGGGCCCCCTGGAAGGGCCCTATCGTCTCAAGCAGCTCCACTTCCACTGGGGCAAGAAGCG
CGACATGGGCTCAGAGCACACAGTGGACGGCAAGTCCTTCCCCAGCGAGCTACATCTGGTTCACTGGAAC
GCCAAGAAGTACAGCACTTTTGGGGAGGCGGCTGCAGCCCCTGATGGCCTGGCTGTGGTTGGTGTCTTCC
TGGAGACAGGAGATGAGCACCCAAGCATGAACCGCCTGACAGACGCCCTCTACATGGTTCGATTTAAGGA
CACCAAGGCCCAGTTCAGCTGCTTCAACCCCAAGTGCCTGCTGCCCACCAGCCGACACTACTGGACCTAT
CCTGGCTCCCTGACCACACCCCCACTCAGTGAGAGTGTCACTTGGATTGTGCTTCGGGAGCCCATCAGGA
TCTCCGAGAGGCAGATGGAGAAATTCCGGAGCCTGCTTTTCACCTCAGAGGATGATGAGAGGATCCATAT
GGTGGACAACTTCCGGCCACCACAGCCGCTGAAGGGCCGAGTGGTCAAAGCATCCTTCCAGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001301164
ORF Size 627 bp
Insert Size 627
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001301164.1, NP_001288093
RefSeq Size 1943
RefSeq ORF 627
Locus ID 12354
Cytogenetics 8|8 D3
Gene Summary Reversible hydration of carbon dioxide. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.