Rgs20 (NM_001290372) Mouse Untagged Clone

CAT#: MC226306

Rgs20 (untagged) - Mouse regulator of G-protein signaling 20 (Rgs20), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rgs20
• Synonyms: 2900073E09Rik; Rgsz1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226306 representing NM_001290372
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCGGATGCGGCAGATGTGCGGCGGAAGTGAGACCCAGGGCCCTGCCCCAAGCCAGCAGGGTGGCCGGG
  GCTCCAACGCCTGCTGCTTCTGTTGGTGCTGCTGCTGCACCTGTTCTTGCCTCACTGTCAGAAACCAAGA
  AGACCAGAGACCCCAAAGAGCCTCCCATGAAATCAGAACAGACATTCCAGCATGTGAAGAAAGCCCCACG
  CCTACTCTGGAAGAAGTCTGTGCCTGGGCCCAGTCTTTTGATAACCTGATGGTCACTCCAGCCGGAAGAA
  ATGCATTCCGGGAATTTCTTCGAACAGAATTCAGTGAAGAAAACATGCTCTTCTGGATGGCCTGTGAAGA
  ACTGAAAAGGGAAGCTAATAAAAGCACTATTGAGGAGAAAGCAAGGATAATCTATGAGGACTATATTTCT
  ATTCTCTCTCCTAAAGAGGTCAGCTTGGACTCCCGAGTACGAGAGGTTATCAACAGAAACATGGTGGATC
  CATCCCAGCACATATTCGATGACGCTCAACTGCAGATCTACACTCTAATGCACAGAGACTCCTATCCCCG
  CTTCATGAACTCCACAGTCTATAAGGATTTGCTTACGTCCTTAGCTGAGAAAACAGTTGAAGCATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290372
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290372.1, NP_001277301.1
• RefSeq Size: 1708 bp
• RefSeq ORF: 627 bp
• Locus ID: 58175
• UniProt ID: Q9QZB1
• Cytogenetics: 1 A1
• Gene Summary: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds selectively to G(z)-alpha and G(alpha)-i2 subunits, accelerates their GTPase activity and regulates their signaling activities. The G(z)-alpha activity is inhibited by the phosphorylation and palmitoylation of the G-protein. Negatively regulates mu-opioid receptor-mediated activation of the G-proteins.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded protein (isoform 3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.