Nudt7 (NM_001290180) Mouse Untagged Clone
CAT#: MC226305
Nudt7 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 7 (Nudt7), transcript variant 3
"NM_001290180" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nudt7 |
Synonyms | 1300007B24Rik; 2210404C19Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226305 representing NM_001290180
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGCGTCAGAACTATTTGCTTCCCGAAGTCTCCTGCTGCTAGTAAGAGGAAGTACTGCAGGGCTGATG TCGCGACCTTGTGGACTCCCGGAGCCTGTCAGCTGAAAAGGGAACCTGGAGAAGTCTGCTTCCCTGGAGG AAAGAGGGACCCGGTGGACACAGATGACACAGCCACTGCTCTCCGTGAAGCCCAGGAGGAGGTGGGGCTG CATCCCCACCAAGTGGAGGTGGTCTCTCACCTGGTGCCATACGTATTTGATAATGATGCACTGGTAACCC CCGTAGTGGGTTTTCTAGACCACAACTTCCAGGCCCAACCTAATGCTGATGAAGTGAAGGAAGTCTTCTT TGTGCCTTTGGACTATTTCCTCCATCCCCAAGTCTACTACCAGAAGCAAATCACACAGTCTGGCCGTGAT TTCATCATGCATTGCTTCGAGTACAAAGACCCTGAGACTGGTGTGAACTACCTAATCCAGGGAATGACCT CAAAACTGGCTGTGTTGGTGGCCTTAATTATTTTGGAACAAAGTCCTGCCTTCAAGATTGATTTTGATCT CCATGACCTGATACCGTCTTGTGAAAGGACCTTCCTTTGGAGATATTCTTTAAGCAAGTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290180 |
Insert Size | 624 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290180.1, NP_001277109.1 |
RefSeq Size | 945 bp |
RefSeq ORF | 624 bp |
Locus ID | 67528 |
UniProt ID | Q99P30 |
Cytogenetics | 8 E1 |
Gene Summary | Coenzyme A diphosphatase which mediates the cleavage of CoA, CoA esters and oxidized CoA with similar efficiencies, yielding 3',5'-ADP and the corresponding 4'-phosphopantetheine derivative as products. CoA into 3',5'-ADP and 4'-phosphopantetheine. Has no activity toward NDP-sugars, CDP-alcohols, (deoxy)nucleoside 5'-triphosphates, nucleoside 5'-di or monophosphates, diadenosine polyphosphates, NAD, NADH, NADP, NADPH or thymidine-5'-monophospho-p-nitrophenyl ester. May be required to eliminate oxidized CoA from peroxisomes, or regulate CoA and acyl-CoA levels in this organelle in response to metabolic demand. Does not play a role in U8 snoRNA decapping activity. Binds U8 snoRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region, resulting in translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228516 | Nudt7 (myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 7 (Nudt7), transcript variant 3 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review