Ube2t (NM_001278115) Mouse Untagged Clone

CAT#: MC226282

Ube2t (untagged) - Mouse ubiquitin-conjugating enzyme E2T (putative) (Ube2t), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ube2t
• Synonyms: 2700084L22Rik; C80607
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226282 representing NM_001278115
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGAGAGCCTCACGCCTGAAGAAGGAACTGCACATGCTAGCCATCGAACCTCCCCCGGGCATCACGT
  GCTGGCAGGAAAAGGATCAAGTGGCTGATTTGCGAGCTCAAATACTAGGTGGAGCTAATACACCTTATGA
  GAAAGGTGTTTTCACACTGGAAGTTATCATTCCTGAGAGGTACCCATTTGAACCTCCACAGGTCCGATTT
  CTAACTCCAATCTATCATCCAAACATTGATTCTAGTGGAAGGATTTGTCTAGATATTCTCAAATTGCCAC
  CAAAGGGTGCATGGAGACCATCCCTCAACATTGCCACTGTATTGACCTCTATTCAGCTGCTCATGGCAGA
  ACCCAATCCTGATGACCCACTAATGGCTGACATTTCTTCAGAATTTAAATATAACAAGATAGCTTTTCTC
  AAGAAAGCCAAGCAGTGGACAGAGGCTCATGCAAGACAGAAACAAAAGGCTGATGAAGAGGAGCTAGGCA
  CCTCATCAGAAGTTGGTGACTCTGAGGAAAGCCATTCCACACAGAAAAGGAAGGCCAGGCCATTAGGAGG
  AATGGAAAAAAAGTTTTCCCCTGACGTTCAGAGAGTCTATCCTGGTCCCTCTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278115
• Insert Size: 615 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278115.1, NP_001265044.1
• RefSeq Size: 957 bp
• RefSeq ORF: 615 bp
• Locus ID: 67196
• UniProt ID: Q9CQ37
• Cytogenetics: 1 E4
• Gene Summary: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Catalyzes monoubiquitination. Involved in mitomycin-C (MMC)-induced DNA repair: acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway. Also mediates monoubiquitination of FANCL and FANCI. May contribute to ubiquitination and degradation of BRCA1. In vitro able to promote polyubiquitination using all 7 ubiquitin Lys residues, but may prefer 'Lys-11'-, 'Lys-27'-, 'Lys-48'- and 'Lys-63'-linked polyubiquitination.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.