Ms4a2 (NM_001276330) Mouse Untagged Clone

CAT#: MC226274

Ms4a2 (untagged) - Mouse membrane-spanning 4-domains, subfamily A, member 2 (Ms4a2), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ms4a2
• Synonyms: Fce1b; Fcer1; Fcer1b; fcERI; FcR; FcRB; Fcrbe; Fcrbeta; Ms4a1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226274 representing NM_001276330
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACACAGAAAATAGGAGCAGAGCAGATCTTGCTCTCCCAAATCCACAAGAATCCTCCAGTGCACCTG
  ACATTGAACTCTTGGAAGCATCTCCTGCCAAAGCAGCCCCACCAAAGCAGACATGGCGGACATTTTTGAA
  GAAAGAGTTGGAGTTCCTGGGAGCAACACAAATTCTGGTTGGTTTGATATGCCTTTGTTTTGGAACAATT
  GTCTGCTCCGTACTCTATGTTTCAGACTTTGATGAAGAAGTGCTTTTACTTTATAAACTAGGCTATCCAT
  TCTGGGGTGCAGTGCTGTTTGTTTTGTCTGGATTTTTGTCAATTATCTCCGAAAGAAAAAACACATTGTA
  TCTGAGACACCGTCCTCCCTTTGGAATCTCCATCTCTAAAATAGAGTTCTGTACTAAGGAGGAACTGGTG
  TTGATGATGCTGTTTCTCACCATCCTGGCCTTTTGCAGTGCTGTGTTGTTCACTATCTATAGGATTGGAC
  AAGAGTTAGAAAGTAAAAAGGTCCCAGATGATCGTCTTTATGAAGAATTAAATGTGTATTCACCAATTTA
  CAGTGAGTTGGAAGACAAAGGGGAAACATCTTCTCCAGTTGATTCATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276330
• Insert Size: 609 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276330.1, NP_001263259.1
• RefSeq Size: 2660 bp
• RefSeq ORF: 609 bp
• Locus ID: 14126
• Cytogenetics: 19 8.46 cM
• Gene Summary: This gene encodes a member of the membrane-spanning 4A family. The encoded protein is the beta subunit of the high affinity IgE receptor and is localized to the membrane. The encoded protein is required for full activation of mast cells, including the release of histamine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (4) lacks an in-frame exon and includes an alternate in-frame exon, compared to variant 1. The encoded isoform (d) is shorter than isoform a.