Taz (NM_001242615) Mouse Untagged Clone
CAT#: MC226273
Taz (untagged) - Mouse tafazzin (Taz), transcript variant 3
"NM_001242615" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Taz |
Synonyms | 5031411C02Rik; 9130012G04Rik; AW107266; AW552613; G4.5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226273 representing NM_001242615
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCCTCCATGTGAAGTGGCCATTCCCCGCGGTGCCCCGGCTCACCTGGACTCTAGCCAGCAGCGTCG TCATGGGCCTAGTTGGCACCTACAGCTGCTTCTGGACCAAGTACATGAACCACCTCACCGTGCACAACAA GGAAGTGCTGTATGAGCTCATTGAGAACCGAGGCCCTGCCACCCCCCTTATCACCGTCTCCAACCACCAG TCTTGCATGGATGACCCTCATCTCTGGGGGATCCTAAAACTCCGCCACATCTGGAACCTGAAGTTGATGC GTTGGACCCCAGCAGCTGCAGACATCTGCTTCACCAAGGAGCTGCACTCCCATTTCTTCAGCTTGGGCAA ATGTGTGCCTGTGTGTCGAGGAGATGGTGTCTACCAGAAAGGGATGGACTTCATTTTGGAGAAGCTTAAC CATGGGGACTGGGTGCACATCTTCCCAGAAGGGAAAGTAAACATGAGTTCTGAGTTCCTGCGCTTCAAAT GGGTAGGAATTGGACGGCTGATTGCTGAGTGTCATCTGAATCCCATCATCCTGCCACTGTGGCATGTTGA AAATCACCGTGCTGATTGGGAAGCCCTTCAGTACACTCCCTGTGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242615 |
Insert Size | 609 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242615.2, NP_001229544.1 |
RefSeq Size | 1780 bp |
RefSeq ORF | 609 bp |
Locus ID | 66826 |
Cytogenetics | X 37.95 cM |
Gene Summary | This gene encodes a mitochondrial phospholipid-lysophospholipid transacylase necessary for normal composition and content of cardiolipin. In humans, mutations of this gene result in Barth syndrome, most often characterized by cardioskeletal myopathy, neutropenia and abnormal mitochondria. This gene is distinct from the gene encoding transcriptional coactivator with PDZ binding motif. Both genes share the gene symbol Taz. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (3) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228484 | Taz (myc-DDK-tagged) - Mouse tafazzin (Taz), transcript variant 3 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review