Prn (NM_001278258) Mouse Untagged Clone

CAT#: MC226226

Prn (untagged) - Mouse prion protein gene complex (Prn), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Prn
• Synonyms: Gm28045; Gm44637; Prnp-Prnd
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226226 representing NM_001278258
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGGAGTGGAGGTCGCTTCGAGTGGAGGTCGCTTCGCGCACCGGATTCACCATGAAGAACCGGCTGG
  GTACATGGTGGGTGGCCATCCTCTGCATGCTGCTTGCCAGCCACCTCTCCACGGTCAAGGCAAGGGGCAT
  AAAGCACAGGTTCAAGTGGAACCGGAAGGTCCTGCCCAGCAGCGGCGGCCAGATCACCGAAGCTCGGGTA
  GCTGAGAACCGCCCAGGAGCCTTCATCAAGCAAGGCCGGAAGCTGGACATCGACTTTGGAGCAGAGGGCA
  ACAGGTACTACGCGGCTAACTATTGGCAGTTCCCTGATGGGATCTACTACGAAGGCTGCTCTGAAGCCAA
  CGTGACCAAGGAGATGCTGGTGACCAGCTGCGTCAACGCCACCCAGGCGGCCAACCAGGCTGAGTTCTCC
  CGGGAGAAGCAGGATAGCAAGCTCCACCAGCGAGTCCTGTGGCGGCTGATCAAAGAGATCTGCTCCGCCA
  AGCACTGCGATTTCTGGCTGGAAAGGGGAGCTGCGCTTCGGGTCGCCGTGGACCAACCGGCGATGGTCTG
  CCTGCTGGGTTTCGTTTGGTTCATTGTGAAGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278258
• Insert Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278258.1, NP_001265187.1
• RefSeq Size: 3400 bp
• RefSeq ORF: 594 bp
• Locus ID: 111368
• Cytogenetics: 2
• Gene Summary: This locus represents naturally occurring readthrough transcription between the neighboring Prnp (major prion protein) and Prnd (prion-like protein doppel) genes on chromosome 2. The readthrough transcript encodes a protein that shares sequence identity with the downstream gene product but its N-terminal region is distinct due to the presence of an in-frame, upstream AUG compared to the downstream gene. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript was derived from the reference genome assembly. The genomic coordinates were determined from alignments.