Rcan2 (NM_001286654) Mouse Untagged Clone

CAT#: MC226225

Rcan2 (untagged) - Mouse regulator of calcineurin 2 (Rcan2), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rcan2
• Synonyms: Csp2; Dscr1l1; MCIP2; ZAKI-4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226225 representing NM_001286654
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCAGCCCCTAGCATGGACTGTGATGTTTCCACTCTGGTCGCCTGTGTGGTGGATGTGGAGGTCTTTA
  CCAATCAGGAGGTTAAGGAAAAATTCGAGGGACTGTTCCGGACCTATGATGAATGTGTGACGTTCCAGCT
  GTTTAAGAGTTTCCGACGGGTTCGAATAAATTTCAGCCATCCCAAATCTGCAGCCCGTGCCCGGATAGAG
  CTTCATGAGACTCAGTTCAGAGGGAAGAAGCTAAAACTCTACTTCGCCCAGGTCCAGACCCCAGAGACAG
  ATGGAGACAAACTGCATTTGGCACCTCCACAGCCTGCCAAACAGTTCCTCATCTCACCCCCTTCATCTCC
  TCCTGTTGGCTGGAAGCCTATCAGCGATGCCACACCAGTCCTCAACTATGACCTTCTTTATGCTGTGGCC
  AAACTAGGACCAGGAGAGAAATATGAGCTGCACGCTGGAACTGAGTCTACACCGAGCGTCGTGGTGCATG
  TGTGTGACAGCGACATGGAGGAGGAGGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATCCAGACCCG
  GCGTCCCGGCCTGCCACCCTCCGTGTCCAACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286654
• Insert Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286654.1, NP_001273583.1
• RefSeq Size: 3107 bp
• RefSeq ORF: 594 bp
• Locus ID: 53901
• UniProt ID: Q9JHG2
• Cytogenetics: 17 19.77 cM
• Gene Summary: Inhibits calcineurin-dependent transcriptional responses by binding to the catalytic domain of calcineurin A. Could play a role during central nervous system development.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, compared to variant 1. The resultign isoform (2) has a shorter and distinct N-terminus, compared to isoform 1. Variants 2 and 4 encode the same isoform 2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.